LXL04_019428 | RubberDandelionOmics

Gene overview

LXL04_019428

Reference: OH-1004 Chr: Chr04 Coordinates: 31120193-31122912 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

882 bp · LXL04_019428|LXL04_019428|OH1004|cDNA

ATGTATTCTTCGTCTACCGGAGAATTTGATAGGATTCCTCTGGATATATTTATGCGAATCGTGAAGCTGCTAGCTCCGAAGGAGGTCGCTATGCTGACGGCAGTTTGCAAGTCGTGGAAATTAATTGTCTCTGATAATAGGTTATGGGTGTCCTACCTCCAGAACCAGCATCTTCCCTGTCGTGACCTTCAATTTTGGTTGTTAAAATTCTTGTTTGTACTAACTTACGAATTTCTTCATGAAGTTTTTGGGTATGAGCC...

CDS

Download CDS FASTA

882 bp · LXL04_019428|LXL04_019428|OH1004|CDS

ATGTATTCTTCGTCTACCGGAGAATTTGATAGGATTCCTCTGGATATATTTATGCGAATCGTGAAGCTGCTAGCTCCGAAGGAGGTCGCTATGCTGACGGCAGTTTGCAAGTCGTGGAAATTAATTGTCTCTGATAATAGGTTATGGGTGTCCTACCTCCAGAACCAGCATCTTCCCTGTCGTGACCTTCAATTTTGGTTGTTAAAATTCTTGTTTGTACTAACTTACGAATTTCTTCATGAAGTTTTTGGGTATGAGCC...

Protein

Download Protein FASTA

293 aa · LXL04_019428|LXL04_019428|OH1004|PROTEIN

MYSSSTGEFDRIPLDIFMRIVKLLAPKEVAMLTAVCKSWKLIVSDNRLWVSYLQNQHLPCRDLQFWLLKFLFVLTYEFLHEVFGYEPHSVWPIGVIALTNVTGFMPLPKTKVLASTAVFYTPFMRHIWTWIGFTEASRENFSSLLKSGYSCVIVPGGTQETFYMEHDSENVFLKTRKGFVRLAMENNCPLVPVFAFGQSYAYKWWKPRGELFLKFSRAIRFTPIAFWGILGSPLPFYQPIQVVVGRPINLKKHTTPTMEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019428`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019428

Location Chr04:31120193-31122912 (+)

Description Similar to DGAT2: Diacylglycerol O-acyltransferase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51520`	Involved in triacylglycerol (TAG) synthesis.	AtDGAT2 is a functional acyl-CoA:diacylglycerol acyltransferase and displays different acyl-CoA substrate preferences than AtDGAT1.2013 · DOI: 10.1016/j.febslet.2013.06.003 Function and localization of the Arabidopsis thaliana diacylglycerol acyltransferase DGAT2 expressed in yeast.2014 · DOI: 10.1371/journal.pone.0092237

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019428 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006071 glycerol metabolic process Biological Process

GO:0006640 monoacylglycerol biosynthetic process Biological Process

GO:0006651 diacylglycerol biosynthetic process Biological Process

GO:0006672 ceramide metabolic process Biological Process

GO:0019432 triglyceride biosynthetic process Biological Process

GO:0019915 lipid storage Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0035356 intracellular triglyceride homeostasis Biological Process

GO:0046460 neutral lipid biosynthetic process Biological Process

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ago:AGOS_ACR140C

ath:AT3G51520

ddi:DDB_G0290279

gmx:100784657

rcu:8258757

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.395

Rank 1 · LXL04_019428 · OH-1004

Mitochondrion0.283

Rank 2 · LXL04_019428 · OH-1004

Cytoplasm0.110

Rank 3 · LXL04_019428 · OH-1004

Peroxisome0.101

Rank 4 · LXL04_019428 · OH-1004

Nucleus0.066

Rank 5 · LXL04_019428 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937.13F-box-like9-51 aa

PF00646.39F-box9-50 aa

PF03982.19DAGAT82-286 aa

PF01553.27Acyltransferase96-193 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019428	`PF12937.13`	F-box-like	9	51	1.1e-08	35.4
LXL04_019428	`PF00646.39`	F-box	9	50	1.2e-06	28.9
LXL04_019428	`PF03982.19`	DAGAT	82	286	4.2e-63	213.7
LXL04_019428	`PF01553.27`	Acyltransferase	96	193	3.1e-06	27.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASU1`	Arabidopsis thaliana	Diacylglycerol O-acyltransferase 2	66.079%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card