TkA02G454210 | RubberDandelionOmics

Gene overview

TkA02G454210

Reference: TK1151 Chr: Chr02 Coordinates: 115671968-115673655 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1145 bp · TkA02G454210|TK1151|cDNA

GAAATTGCACACGTAATCACAAACCTGATCTCTTGCGACAGCAATCACACTAAAATAATGATCCGCGTGTCTCGGTAACGTTTTAACAAAATTCCTCCGGCACAAAATGTCTGCTATTAGAATCCATCCTCCTGCGACGGCGTTATCGGTATCTATCAAACACCTTACCTGCAACCCAAATACCCACCTCTTCACCACCAATTGTCGCAATTTAAAGCGTTCAGCCTTCAGAAGAAACCTAACCGTCTTCGCTATGTCGT...

CDS

Download CDS FASTA

795 bp · TkA02G454210|TK1151|CDS

ATGTCTGCTATTAGAATCCATCCTCCTGCGACGGCGTTATCGGTATCTATCAAACACCTTACCTGCAACCCAAATACCCACCTCTTCACCACCAATTGTCGCAATTTAAAGCGTTCAGCCTTCAGAAGAAACCTAACCGTCTTCGCTATGTCGTCCGACCCTCTCGAAGTCTGCGCCAAATCGTCTATCACCGTTCCCAATAGGCTCGGCGATTGCCCTTTTACGCAGAGAGTATTGCTGACTCTGGAGGAGAAGCATCT...

Protein

Download Protein FASTA

264 aa · TkA02G454210|TK1151|PROTEIN

MSAIRIHPPATALSVSIKHLTCNPNTHLFTTNCRNLKRSAFRRNLTVFAMSSDPLEVCAKSSITVPNRLGDCPFTQRVLLTLEEKHLPYNLKLIDLGNKPEWFLSISPEGKVPVVKLDDKWIADSDVITKTVEEKFPEPPLSTPPEKSSVGSKIFSTYIGFLKSKDAGDGTEQALLNELSTFNDYLKENGPFINGKDISGADLSLGPKLYHMEIALGYYKKWSVPDSLPHLKTYMKTVFSLESFTKTMPLTEDVIEGWRP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G454210`
TK1151 ID	TkA02G454210
OH-1004 ID	LXL04_014034
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G454210

Location Chr02:115671968-115673655 (-)

Description Similar to DHAR2: Probable glutathione S-transferase DHAR2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16710`	Displays a dual function.	No verified direct reference in this release
`At1g19570`	Displays a dual function.	A plant homolog of animal chloride intracellular channels (CLICs) generates an ion conductance in heterologous systems.2007 · DOI: 10.1074/jbc.m607241200
`At1g75270`	Displays a dual function.	Functional divergence in the glutathione transferase superfamily in plants. Identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana.2002 · DOI: 10.1074/jbc.m202919200 Cytosolic dehydroascorbate reductase is important for ozone tolerance in Arabidopsis thaliana.2006 · DOI: 10.1093/pcp/pci246

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0232600`	Involved in ascorbate homeostasis.	No verified direct reference in this release
`Os05g0116100`	Involved in ascorbate homeostasis.	Scavenging reactive oxygen species by rice dehydroascorbate reductase alleviates oxidative stresses in Escherichia coli.2008 · PMID: 19011360 Homologous expression of cytosolic dehydroascorbate reductase increases grain yield and biomass under paddy field conditions in transgenic rice (Oryza sativa L. japonica).2013 · DOI: 10.1007/s00425-013-1862-8 Structural understanding of the recycling of oxidized ascorbate by dehydroascorbate reductase (OsDHAR) from Oryza sativa L. japonica.2016 · DOI: 10.1038/srep19498

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014034 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0010193 response to ozone Biological Process

GO:0010731 protein glutathionylation Biological Process

GO:0019852 L-ascorbic acid metabolic process Biological Process

GO:0033355 ascorbate glutathione cycle Biological Process

GO:0034220 monoatomic ion transmembrane transport Biological Process

GO:0043903 regulation of biological process involved in symbiotic interaction Biological Process

GO:0070301 cellular response to hydrogen peroxide Biological Process

GO:0080151 positive regulation of salicylic acid mediated signaling pathway Biological Process

KEGG gene cross-reference

ath:AT1G19570

ath:AT1G75270

ath:AT5G16710

dosa:Os05g0116100

dosa:Os06g0232600

osa:4337622

osa:4340581

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.965

Rank 1 · TkA02G454210 · TK1151

Mitochondrion0.066

Rank 2 · TkA02G454210 · TK1151

Cytoplasm0.034

Rank 3 · TkA02G454210 · TK1151

Peroxisome0.018

Rank 4 · TkA02G454210 · TK1151

Nucleus0.016

Rank 5 · TkA02G454210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02798GST_N10-27 aa

PF22441CLIC-like_N67-137 aa

PF13417GST_N_371-140 aa

PF02798GST_N71-129 aa

PF13409GST_N_272-134 aa

PF17172GST_N_4105-140 aa

PF10568Tom37105-136 aa

PF00043GST_C164-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G454210	`PF02798`	GST_N	10	27	9.9e-08	32.9
TkA02G454210	`PF22441`	CLIC-like_N	67	137	5.2e-08	33.7
TkA02G454210	`PF13417`	GST_N_3	71	140	2.8e-18	66.7
TkA02G454210	`PF02798`	GST_N	71	129	9.9e-08	32.9
TkA02G454210	`PF13409`	GST_N_2	72	134	6.1e-18	65.9
TkA02G454210	`PF17172`	GST_N_4	105	140	0.00057	21.2
TkA02G454210	`PF10568`	Tom37	105	136	0.13	13.4
TkA02G454210	`PF00043`	GST_C	164	242	0.0017	19.3
TkA02G454210	`PF14497`	GST_C_3	171	242	0.0014	19.5
TkA02G454210	`PF13410`	GST_C_2	172	236	1.7e-05	25.6
TkA02G454210	`PF16865`	GST_C_5	187	237	0.11	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LE52`	Arabidopsis thaliana	sp\|Q8LE52\|DHAR3_ARATH Glutathione S-transferase DHAR3, chloroplastic	65.000%	Swiss-Prot	High
`Q9FWR4`	Arabidopsis thaliana	sp\|Q9FWR4\|DHAR1_ARATH Glutathione S-transferase DHAR1, mitochondrial	59.800%	Swiss-Prot	High
`Q9FRL8`	Arabidopsis thaliana	sp\|Q9FRL8\|DHAR2_ARATH Glutathione S-transferase DHAR2	59.800%	Swiss-Prot	High
`Q67UK9`	Oryza sativa subsp. japonica	sp\|Q67UK9\|DHAR2_ORYSJ Probable glutathione S-transferase DHAR2, chloroplastic	76.600%	Swiss-Prot	High
`Q65XA0`	Oryza sativa subsp. japonica	sp\|Q65XA0\|DHAR1_ORYSJ Probable glutathione S-transferase DHAR1, cytosolic	59.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card