TkA02G447640 | RubberDandelionOmics

Gene overview

TkA02G447640

Reference: TK1151 Chr: Chr02 Coordinates: 113813444-113820876 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1492 bp · TkA02G447640|TK1151|cDNA

GTTTTTGGTAAGCAACTTTGTAGGCTGATTCTAGCCAAACCCACCTAGCTAAGCCATATATCTACCCCCTCTCACAACCCACTTTGCTGACTCCTAAACGCCCTTTCTACCTCTCTCTAAAAAACCTCCCATAAATCTAGAGAGAGAAAATGAAGAGAAGAAGGCTGTCACCAACTTCATCGTCATCCTGTTCATCTTCATCTTCATGCATTAACGAACACCAGGTTCCGAAGCCCAAACGATCCTCTAGACCCCACAAC...

CDS

Download CDS FASTA

1062 bp · TkA02G447640|TK1151|CDS

ATGCTGCTGCTGAAAACACCCGCAGAAGCTCAATTTACAGAGGTGTTACCAGGCATAGATGGACAGGAAGATTTGAAGCACATCTATGGGACAAGGGTACATGGAACAACATCCAGAACAAGAAAGGGAAACAAATGTGATCCCCGGTTCCTAATTTCCACCATGAATTCTGCATTTATAGTTTATTTAGGGGCATATGATAGTGAAGAGGCTGCTGCTCGTACCTACGATCTTGCGGCCCTTAAATACTGGGGACAAGA...

Protein

Download Protein FASTA

353 aa · TkA02G447640|TK1151|PROTEIN

MLLLKTPAEAQFTEVLPGIDGQEDLKHIYGTRVHGTTSRTRKGNKCDPRFLISTMNSAFIVYLGAYDSEEAAARTYDLAALKYWGQDTTLNFEIDTYKKEIEEMEKLSKDEYLASLRRRSSGFSRGVSKYRGVARHHHNGRWEARIGRVLGNKYLYLGTYSTQEEAAAAYDLAAIEYRGAKAVTNFDISIYTDRLKDGVSQIQSTPDQSTEVIASFINEQNEEVDHHDLNCQPPPQQQQQEETTIVAKEESLHEMHDLDF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G447640`
TK1151 ID	TkA02G447640
OH-1004 ID	LXL04_014208
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	72.700
Protein coverage (%)	TK1151 81.870 / OH-1004 81.109 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G447640

Location Chr02:113813444-113820876 (+)

Description Similar to WRI1: Ethylene-responsive transcription factor WRI1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54320`	May be involved in the regulation of gene expression by stress factors and by components of stress signal transduction pathways (By similarity).	Contrapuntal networks of gene expression during Arabidopsis seed filling.2002 · DOI: 10.1105/tpc.000877 WRINKLED1 encodes an AP2/EREB domain protein involved in the control of storage compound biosynthesis in Arabidopsis.2004 · DOI: 10.1111/j.1365-313x.2004.02235.x ACTIVATOR of Spomin::LUC1/WRINKLED1 of Arabidopsis thaliana transactivates sugar-inducible promoters.2005 · DOI: 10.1093/pcp/pci072 A spatiotemporal analysis of enzymatic activities associated with carbon metabolism in wild-type and mutant embryos of Arabidopsis using in situ histochemistry.2006 · DOI: 10.1111/j.1365-313x.2006.02682.x WRI1 is required for seed germination and seedling establishment.2006 · DOI: 10.1104/pp.106.079574 wrinkled1: A novel, low-seed-oil mutant of Arabidopsis with a deficiency in the seed-specific regulation of carbohydrate metabolism.1998 · DOI: 10.1104/pp.118.1.91
`At1g16060`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At1g79700`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At1g51190`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At5g17430`	Transcription factor that, in opposition to HDG1, promotes cell proliferation and morphogenesis via transcriptional activation of meristem and cell proliferation genes, but prevents differentiation, especially during embryogenesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0389000`	Transcription activator involved in the control of organ size.	A novel AP2-type transcription factor, SMALL ORGAN SIZE1, controls organ size downstream of an auxin signaling pathway.2014 · DOI: 10.1093/pcp/pcu023 SMALL ORGAN SIZE 1 and SMALL ORGAN SIZE 2/DWARF AND LOW-TILLERING Form a Complex to Integrate Auxin and Brassinosteroid Signaling in Rice.2017 · DOI: 10.1016/j.molp.2016.12.013 The RLA1/SMOS1 Transcription Factor Functions with OsBZR1 to Regulate Brassinosteroid Signaling and Rice Architecture.2017 · DOI: 10.1105/tpc.16.00611
`Os07g0124700`	Acts as a positive regulator of adventitious (crown) root formation by promoting its initiation.	The auxin responsive AP2/ERF transcription factor CROWN ROOTLESS5 is involved in crown root initiation in rice through the induction of OsRR1, a type-A response regulator of cytokinin signaling.2011 · DOI: 10.1111/j.1365-313x.2011.04610.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014208 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0006109 regulation of carbohydrate metabolic process Biological Process

GO:0006110 regulation of glycolytic process Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0007389 pattern specification process Biological Process

GO:0008610 lipid biosynthetic process Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009737 response to abscisic acid Biological Process

KEGG gene cross-reference

ath:AT1G16060

ath:AT1G51190

ath:AT3G54320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.889

Rank 1 · TkA02G447640 · TK1151

Cytoplasm0.163

Rank 2 · TkA02G447640 · TK1151

Cell membrane0.040

Rank 3 · TkA02G447640 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA02G447640 · TK1151

Plastid0.026

Rank 5 · TkA02G447640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05036SPOR57-74 aa

PF00847AP261-85 aa

PF27115Cho_C62-98 aa

PF00847AP2128-179 aa

PF27115Cho_C155-191 aa

PF05036SPOR155-170 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G447640	`PF05036`	SPOR	57	74	0.11	13.6
TkA02G447640	`PF00847`	AP2	61	85	3.5e-15	56.7
TkA02G447640	`PF27115`	Cho_C	62	98	0.0059	17.1
TkA02G447640	`PF00847`	AP2	128	179	3.5e-15	56.7
TkA02G447640	`PF27115`	Cho_C	155	191	0.0059	17.1
TkA02G447640	`PF05036`	SPOR	155	170	0.11	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6X5Y6`	Arabidopsis thaliana	sp\|Q6X5Y6\|WRI1_ARATH Ethylene-responsive transcription factor WRI1	67.200%	Swiss-Prot	High
`Q94AN4`	Arabidopsis thaliana	sp\|Q94AN4\|AP2L1_ARATH AP2-like ethylene-responsive transcription factor At1g16060	69.200%	Swiss-Prot	Medium
`A0JPZ8`	Arabidopsis thaliana	sp\|A0JPZ8\|AP2L3_ARATH AP2-like ethylene-responsive transcription factor At1g79700	67.300%	Swiss-Prot	Medium
`Q5YGP7`	Arabidopsis thaliana	sp\|Q5YGP7\|PLET2_ARATH AP2-like ethylene-responsive transcription factor PLT2	61.500%	Swiss-Prot	Medium
`Q6PQQ4`	Arabidopsis thaliana	sp\|Q6PQQ4\|BBM_ARATH AP2-like ethylene-responsive transcription factor BBM	66.700%	Swiss-Prot	Low
`X5HYT8`	Oryza sativa subsp. japonica	sp\|X5HYT8\|SMOS1_ORYSJ AP2-like ethylene-responsive transcription factor SMOS1	61.400%	Swiss-Prot	Medium
`Q84Z02`	Oryza sativa subsp. japonica	sp\|Q84Z02\|CRL5_ORYSJ AP2-like ethylene-responsive transcription factor CRL5	75.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card