TkA02G446830 | RubberDandelionOmics

Gene overview

TkA02G446830

Reference: TK1151 Chr: Chr02 Coordinates: 113591738-113593224 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1123 bp · TkA02G446830|TK1151|cDNA

ACCAGATTCAACCTACCCGACCCTTCTCCGTTCATTCTCTGTTTACCCCTTTCTTCTCATGTAATTCGTCCATAATCCTTTTCTGGCGTTTATTTCAATTATCCGGCGAAATCATTTCTTACCGCATAGGACGAAACTAATTTCTGCCAGAGGTCTTCTATCAGGTTCATTCAAGATATTTGACAATATGCCCCCACGGATCGCACAAATCCGACTCGTGAGCTCACACCCACAAGTCTACGCACCATGTGACGACTCCT...

CDS

Download CDS FASTA

762 bp · TkA02G446830|TK1151|CDS

ATGCCCCCACGGATCGCACAAATCCGACTCGTGAGCTCACACCCACAAGTCTACGCACCATGTGACGACTCCTACGCATTAGTCGACGCCCTCCTAGCCGACCGGAAAAAACTCATCGACCACCACCCCACTATCTGCATGGAAGTCGGTTCCGGCAGCGGCTACGTCATCACCAGCCTCGCCCTCATCCTCAAGTCCGAATCAAACTCCCCCCACTTTTTCGCAACCGACGTCAACCCTCACGCCACCCTCGTCACCCG...

Protein

Download Protein FASTA

253 aa · TkA02G446830|TK1151|PROTEIN

MPPRIAQIRLVSSHPQVYAPCDDSYALVDALLADRKKLIDHHPTICMEVGSGSGYVITSLALILKSESNSPHFFATDVNPHATLVTRDTLEAHGVHAELLTTNITSGLEKRLAGMVDVMVVNPPYVPTPEEEVGNGGLSAAWAGGENGRAVIDKILPVADTLLSEKGWLYMLFLAANDPLQICLEMRDRGYGSKIVVQRSTEEETLHVIKFWRESENQMEGSEGGSTPKSGSQKGWNYIFSQLSRLTFRETRQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G446830`
TK1151 ID	TkA02G446830
OH-1004 ID	LXL04_014222
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 94.052 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G446830`
Location	Chr02:113591738-113593224 (+)
Description	Similar to N6amt1: Methyltransferase N6AMT1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014222` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002184 cytoplasmic translational termination Biological Process GO:0006417 regulation of translation Biological Process GO:0009404 toxin metabolic process Biological Process GO:0018364 peptidyl-glutamine methylation Biological Process GO:0018872 arsonoacetate metabolic process Biological Process GO:0030307 positive regulation of cell growth Biological Process GO:0032259 methylation Biological Process GO:0042273 ribosomal large subunit biogenesis Biological Process GO:0045814 negative regulation of gene expression, epigenetic Biological Process GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process GO:0060566 positive regulation of termination of DNA-templated transcription Biological Process GO:0005634 nucleus Cellular Component
KEGG gene cross-reference	hsa:29104 mja:MJ_0928 mmu:67768 sce:YDR140W spo:2542476 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.665

Rank 1 · TkA02G446830 · TK1151

Nucleus0.559

Rank 2 · TkA02G446830 · TK1151

Mitochondrion0.073

Rank 3 · TkA02G446830 · TK1151

Peroxisome0.045

Rank 4 · TkA02G446830 · TK1151

Plastid0.028

Rank 5 · TkA02G446830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13679Methyltransf_3226-103 aa

PF05175MTS46-126 aa

PF13649Methyltransf_2547-121 aa

PF13578Methyltransf_2448-120 aa

PF01170UPF002069-127 aa

PF05175MTS146-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G446830	`PF13679`	Methyltransf_32	26	103	0.06	14.0
TkA02G446830	`PF05175`	MTS	46	126	1.3e-07	32.1
TkA02G446830	`PF13649`	Methyltransf_25	47	121	0.23	12.9
TkA02G446830	`PF13578`	Methyltransf_24	48	120	0.077	14.6
TkA02G446830	`PF01170`	UPF0020	69	127	0.13	12.7
TkA02G446830	`PF05175`	MTS	146	172	1.3e-07	32.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card