Gene Card
Gene overview
cDNA / CDS / Protein Sequences
810 bp · LXL04_014222|LXL04_014222|OH1004|cDNA
ATGAGCGTGATATGGGATGCGAAAGGTTCATTCAAGATATTTGACGATATGCCCCCACGGATCGCACAAATCCGACTCGTGAGCTCACACCCACAAGTCTACGCACCATGTGACGACTCCTACGCATTAGTCGACGCCCTCCTAGCCGACCGGAAAAAACTCATCGACCACCACCCCACTATCTGCATGGAAGTCGGTTCCGGCAGCGGCTACGTCATCACCAGCCTCGCCCTCATCCTCAAGTCCGAATCAAACTCCCC...
810 bp · LXL04_014222|LXL04_014222|OH1004|CDS
ATGAGCGTGATATGGGATGCGAAAGGTTCATTCAAGATATTTGACGATATGCCCCCACGGATCGCACAAATCCGACTCGTGAGCTCACACCCACAAGTCTACGCACCATGTGACGACTCCTACGCATTAGTCGACGCCCTCCTAGCCGACCGGAAAAAACTCATCGACCACCACCCCACTATCTGCATGGAAGTCGGTTCCGGCAGCGGCTACGTCATCACCAGCCTCGCCCTCATCCTCAAGTCCGAATCAAACTCCCC...
Protein
Download Protein FASTA269 aa · LXL04_014222|LXL04_014222|OH1004|PROTEIN
MSVIWDAKGSFKIFDDMPPRIAQIRLVSSHPQVYAPCDDSYALVDALLADRKKLIDHHPTICMEVGSGSGYVITSLALILKSESNSPHFFATDVNPHATLVTRDTLEAHEVHAELLTTNITSGLEKRLAGMVDVMVVNPPYVPTPEEEVGNGGLSAAWAGGENGRAVIDKILPVADNLLSEKGWLYMLFLAANDPLQICLEMRDRGYGSKIVVQRSTEEETLHVIKFWRESENQMEGSEGGSTPKSGSQKGWNYIFSQLS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_014222 |
|---|---|
| TK1151 ID | TkA02G446830 |
| OH-1004 ID | LXL04_014222 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.200 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 94.052Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_014222 |
|---|---|
| Location | Chr03:43909765-43912218 (-) |
| Description | Similar to N6amt1: Methyltransferase N6AMT1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0002184 cytoplasmic translational termination Biological Process GO:0006417 regulation of translation Biological Process GO:0009404 toxin metabolic process Biological Process GO:0018364 peptidyl-glutamine methylation Biological Process GO:0018872 arsonoacetate metabolic process Biological Process GO:0030307 positive regulation of cell growth Biological Process GO:0032259 methylation Biological Process GO:0042273 ribosomal large subunit biogenesis Biological Process GO:0045814 negative regulation of gene expression, epigenetic Biological Process GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process GO:0060566 positive regulation of termination of DNA-templated transcription Biological Process GO:0005634 nucleus Cellular Component |
| KEGG gene cross-reference | hsa:29104 mja:MJ_0928 mmu:67768 sce:YDR140W spo:2542476 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF05175.21MTS62-142 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_014222 | PF05175.21 | MTS | 62 | 142 | 7.5e-08 | 32.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.