TkA02G431510 | RubberDandelionOmics

Gene overview

TkA02G431510

Reference: TK1151 Chr: Chr02 Coordinates: 109581280-109584090 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1863 bp · TkA02G431510|TK1151|cDNA

ATGTCACCAGAACAGAGCGAGGTTACATTTTTTGAAAAGCTTGATCATGAGCTTAATAAGGTCAACACCTTTTATAGGGAAAAAGTTGAAGAAGTGATTAATGAAGCAGCTTCATTGAATAAGCAAATGAATGCTTTGATAGCATTAAGGATCAAGGTAGAACAACCAGATATAAGATCTTCAAATATGAAGTCTCCTAACAGATATAAATCAGAAAAACCCTTGGATGTTCTTGATCGTGTGAAGATTAACAATACTCT...

CDS

Download CDS FASTA

1863 bp · TkA02G431510|TK1151|CDS

ATGTCACCAGAACAGAGCGAGGTTACATTTTTTGAAAAGCTTGATCATGAGCTTAATAAGGTCAACACCTTTTATAGGGAAAAAGTTGAAGAAGTGATTAATGAAGCAGCTTCATTGAATAAGCAAATGAATGCTTTGATAGCATTAAGGATCAAGGTAGAACAACCAGATATAAGATCTTCAAATATGAAGTCTCCTAACAGATATAAATCAGAAAAACCCTTGGATGTTCTTGATCGTGTGAAGATTAACAATACTCT...

Protein

Download Protein FASTA

620 aa · TkA02G431510|TK1151|PROTEIN

MSPEQSEVTFFEKLDHELNKVNTFYREKVEEVINEAASLNKQMNALIALRIKVEQPDIRSSNMKSPNRYKSEKPLDVLDRVKINNTLESPMSTIRSVLNDSKDKDLSFKKEELKEAEGRLKVVFIEFYRKLHLLKHYSYVNLLAFSKIMKKYEKITLRRAARSYMKIVDDSYIGNSDEVTLLLDRVEGTFVKYFANNNRREGMKLLRPKRKREKQRVTFFSGFFCGCSIAIMTAVILLIQARKAMDREEHTMYMENVFPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G431510`
TK1151 ID	TkA02G431510
OH-1004 ID	LXL04_014376
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.200
Protein coverage (%)	TK1151 100.000 / OH-1004 86.575 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G431510

Location Chr02:109581280-109584090 (-)

Description Similar to PHO1-H10: Phosphate transporter PHO1 homolog 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69480`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At1g35350`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At1g26730`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At1g14040`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At4g25350`	May transport inorganic phosphate (Pi).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014376 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0009960 endosperm development Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0045793 positive regulation of cell size Biological Process

GO:0080050 regulation of seed development Biological Process

GO:0080113 regulation of seed growth Biological Process

GO:0005634 nucleus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G26730

ath:AT1G35350

ath:AT1G69480

ath:AT3G29060

ath:AT4G25350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.722

Rank 1 · TkA02G431510 · TK1151

Endoplasmic reticulum0.142

Rank 2 · TkA02G431510 · TK1151

Cytoplasm0.137

Rank 3 · TkA02G431510 · TK1151

Lysosome / Vacuole0.072

Rank 4 · TkA02G431510 · TK1151

Golgi apparatus0.061

Rank 5 · TkA02G431510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03105SPX3-166 aa

PF13664DUF4149234-280 aa

PF03124EXS257-592 aa

PF13664DUF4149307-354 aa

PF13664DUF4149472-506 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G431510	`PF03105`	SPX	3	166	6.1e-40	139.0
TkA02G431510	`PF13664`	DUF4149	234	280	0.21	12.6
TkA02G431510	`PF03124`	EXS	257	592	1.1e-95	321.5
TkA02G431510	`PF13664`	DUF4149	307	354	0.21	12.6
TkA02G431510	`PF13664`	DUF4149	472	506	0.21	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6R8G0`	Arabidopsis thaliana	sp\|Q6R8G0\|PHO1A_ARATH Phosphate transporter PHO1 homolog 10	54.700%	Swiss-Prot	High
`Q6R8G2`	Arabidopsis thaliana	sp\|Q6R8G2\|PHO18_ARATH Phosphate transporter PHO1 homolog 8	53.800%	Swiss-Prot	High
`Q6R8G3`	Arabidopsis thaliana	sp\|Q6R8G3\|PHO17_ARATH Phosphate transporter PHO1 homolog 7	52.800%	Swiss-Prot	High
`Q6R8G7`	Arabidopsis thaliana	sp\|Q6R8G7\|PHO13_ARATH Phosphate transporter PHO1 homolog 3	49.100%	Swiss-Prot	Medium
`Q6R8G6`	Arabidopsis thaliana	sp\|Q6R8G6\|PHO14_ARATH Phosphate transporter PHO1 homolog 4	50.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card