LXL04_014376 | RubberDandelionOmics

Gene overview

LXL04_014376

Reference: OH-1004 Chr: Chr03 Coordinates: 47784125-47787230 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2193 bp · LXL04_014376|LXL04_014376|OH1004|cDNA

ATGAAGTTTGGAAAGGAGTTCAAGCAACAAAAGGTGCCAGAATGGATTGAAGCGTACATGGACTATAACGGACTCAAAAGAATATTACACGTAATCAGACAATGTAAACAGCTAGATGAACCTCCAACACCTATCAGAACTTCACAACAGGGGCTGTCTCTATACAGACCTTTTAGTGGACTAGATGTAAGATCCAACTCTGATGAAAGCACTTCAGACATTGAGGACCAAGTTATAGCCGTTGAAACTGTGAGGCAAGA...

CDS

Download CDS FASTA

2193 bp · LXL04_014376|LXL04_014376|OH1004|CDS

ATGAAGTTTGGAAAGGAGTTCAAGCAACAAAAGGTGCCAGAATGGATTGAAGCGTACATGGACTATAACGGACTCAAAAGAATATTACACGTAATCAGACAATGTAAACAGCTAGATGAACCTCCAACACCTATCAGAACTTCACAACAGGGGCTGTCTCTATACAGACCTTTTAGTGGACTAGATGTAAGATCCAACTCTGATGAAAGCACTTCAGACATTGAGGACCAAGTTATAGCCGTTGAAACTGTGAGGCAAGA...

Protein

Download Protein FASTA

730 aa · LXL04_014376|LXL04_014376|OH1004|PROTEIN

MKFGKEFKQQKVPEWIEAYMDYNGLKRILHVIRQCKQLDEPPTPIRTSQQGLSLYRPFSGLDVRSNSDESTSDIEDQVIAVETVRQDDTTEVYNTNFLMSPEQSEVTFFEKLDHELNKVNTFYREKVEEVINEAASLNKQMNALIALRIKVEQPDISKCHIQRNSGPLGSSNMKSPNRYKSEKPLDVLDRVKINNTLESPMSTIRSVLNDSKDKDLSFKKEELKEAEGRLKVVFIEFYRKLHLLKHYSYVNLLAFSKIMK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014376`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014376

Location Chr03:47784125-47787230 (+)

Description Similar to PHO1-H10: Phosphate transporter PHO1 homolog 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69480`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At1g26730`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At1g35350`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At4g25350`	May transport inorganic phosphate (Pi).	No verified direct reference in this release
`At3g29060`	May transport inorganic phosphate (Pi).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014376 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0009960 endosperm development Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0045793 positive regulation of cell size Biological Process

GO:0080050 regulation of seed development Biological Process

GO:0080113 regulation of seed growth Biological Process

GO:0005634 nucleus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G26730

ath:AT1G35350

ath:AT1G69480

ath:AT3G29060

ath:AT4G25350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.659

Rank 1 · LXL04_014376 · OH-1004

Endoplasmic reticulum0.171

Rank 2 · LXL04_014376 · OH-1004

Cytoplasm0.136

Rank 3 · LXL04_014376 · OH-1004

Lysosome / Vacuole0.098

Rank 4 · LXL04_014376 · OH-1004

Golgi apparatus0.075

Rank 5 · LXL04_014376 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03105.25SPX1-276 aa

PF03124.21EXS367-702 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014376	`PF03105.25`	SPX	1	276	4e-61	208.7
LXL04_014376	`PF03124.21`	EXS	367	702	4.5e-94	316.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6R8G0`	Arabidopsis thaliana	Phosphate transporter PHO1 homolog 10	54.086%	Swiss-Prot	strong database homology
`Q6R8G3`	Arabidopsis thaliana	Phosphate transporter PHO1 homolog 7	52.197%	Swiss-Prot	strong database homology
`Q6R8G2`	Arabidopsis thaliana	Phosphate transporter PHO1 homolog 8	52.128%	Swiss-Prot	strong database homology
`Q6R8G6`	Arabidopsis thaliana	Phosphate transporter PHO1 homolog 4	48.738%	Swiss-Prot	moderate database homology
`Q9LJW0`	Arabidopsis thaliana	Phosphate transporter PHO1 homolog 9	46.058%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card