TkA02G422930 | RubberDandelionOmics

Gene overview

TkA02G422930

Reference: TK1151 Chr: Chr02 Coordinates: 107391147-107393241 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1409 bp · TkA02G422930|TK1151|cDNA

CGAACCCCCGCAGGGGCCCATTGAGTTATATTTACTAGGGTTAATTAGGTAATACCTCATATTCAAAGAAAAAAGCGGCCGCATAGCACAGTTCTTCAATCTTCATCCGCCATCCACGTTTCCAGTTCCACACTTCCACTTCGCGAATCGCGACGCGACCACCGGCGCTCCTCATCGGCCCTCCGGCGCTCCTCCGACGCTCCTCCGACGCTCTGCAGCTCCCTAGACGCGGCGACTCTGCAGTTCTGCTCTTCCTTCCG...

CDS

Download CDS FASTA

849 bp · TkA02G422930|TK1151|CDS

ATGAGATTAAAAAAGCAGAAACGTCATCGCAGAAGTGTTAGATTCTACACAACATGCTTTGGATTCAGATCCCCTTTCAAGATTTTATGTGATGGAACTTTCATACACCATCTTCTTCTTAACCGCATCACTCCAGCTGACACCGCCATTTCCAACATCCTAGGTGCTCCAGTCAAACTATTCACAACCAGATGTGTTCTTGCAGAGCTGAAAAGCCTCGGTGAATCCTACTCTGATTCTCTCAATGTGGCACGTGATCT...

Protein

Download Protein FASTA

282 aa · TkA02G422930|TK1151|PROTEIN

MRLKKQKRHRRSVRFYTTCFGFRSPFKILCDGTFIHHLLLNRITPADTAISNILGAPVKLFTTRCVLAELKSLGESYSDSLNVARDLAPARCDHEKRKSAVACLTEVIGEGNSEHFFVASQDADLRKKFQEIPAVPVIFALRNALFLEPPSQSQQEFAKSAEEERSHMNDVEFKMLTKKKKKTLSSEELGEASDEDEGLPDKILEELKKNADKRKTDVKDKVQFKRKKAKGPNPLSCKKKKNEDKKPAAKNKEGDESAET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G422930`
TK1151 ID	TkA02G422930
OH-1004 ID	LXL04_014474
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G422930`
Location	Chr02:107391147-107393241 (-)
Description	Similar to UTP23: rRNA-processing protein UTP23 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014474` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000447 endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000472 endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000480 endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006364 rRNA processing Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005739 mitochondrion Cellular Component GO:0032040 small-subunit processome Cellular Component GO:0003723 RNA binding Molecular Function GO:0003730 mRNA 3'-UTR binding Molecular Function GO:0004540 RNA nuclease activity Molecular Function
KEGG gene cross-reference	bta:534858 hsa:84294 mmu:78581 sce:YOR004W spo:2539158 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.927

Rank 1 · TkA02G422930 · TK1151

Cytoplasm0.103

Rank 2 · TkA02G422930 · TK1151

Cell membrane0.026

Rank 3 · TkA02G422930 · TK1151

Endoplasmic reticulum0.020

Rank 4 · TkA02G422930 · TK1151

Extracellular0.015

Rank 5 · TkA02G422930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24779UTP23_sensor4-7 aa

PF04900Fcf153-149 aa

PF24779UTP23_sensor178-182 aa

PF24779UTP23_sensor224-241 aa

PF24779UTP23_sensor266-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G422930	`PF24779`	UTP23_sensor	4	7	9.1e-08	32.7
TkA02G422930	`PF04900`	Fcf1	53	149	1.6e-27	96.5
TkA02G422930	`PF24779`	UTP23_sensor	178	182	9.1e-08	32.7
TkA02G422930	`PF24779`	UTP23_sensor	224	241	9.1e-08	32.7
TkA02G422930	`PF24779`	UTP23_sensor	266	270	9.1e-08	32.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card