LXL04_014474 | RubberDandelionOmics

Gene overview

LXL04_014474

Reference: OH-1004 Chr: Chr03 Coordinates: 49991307-49992574 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

883 bp · LXL04_014474|LXL04_014474|OH1004|cDNA

ATCTCTCATCAAATCCTTTGTCTTTCCATTACAGATGAGATTAAAAAAGCAGAAACGTCATCGCAGAAGTGTTAGATTCTACACAACATGCTTTGGATTCAGATCCCCTTTCAAGATTTTATGTGATGGAACTTTCATACACCATCTTCTTCTTAACCGCATCACTCCAGCTGACACCGCCATTTCCAACATCCTAGGTGCTCCAGTCAAACTATTCACAACCAGATGTGTTCTTGCAGAGCTGAAAAGCCTCGGTGAAT...

CDS

Download CDS FASTA

849 bp · LXL04_014474|LXL04_014474|OH1004|CDS

ATGAGATTAAAAAAGCAGAAACGTCATCGCAGAAGTGTTAGATTCTACACAACATGCTTTGGATTCAGATCCCCTTTCAAGATTTTATGTGATGGAACTTTCATACACCATCTTCTTCTTAACCGCATCACTCCAGCTGACACCGCCATTTCCAACATCCTAGGTGCTCCAGTCAAACTATTCACAACCAGATGTGTTCTTGCAGAGCTGAAAAGCCTCGGTGAATCCTACTCTGATTCTCTCAATGTGGCACGTGATCT...

Protein

Download Protein FASTA

282 aa · LXL04_014474|LXL04_014474|OH1004|PROTEIN

MRLKKQKRHRRSVRFYTTCFGFRSPFKILCDGTFIHHLLLNRITPADTAISNILGAPVKLFTTRCVLAELKSLGESYSDSLNVARDLAPARCDHEKRKSAVACLTEVIGEGNSEHFFVASQDADLRKKFQEIPAVPVIFALRNALFLEPPSQSQQEFAKSAEEERSHMNDVEFKMLTKKKKKTLSSEELGEASDEDEGLPDKILEELKKNADKRKTDVKDKVQFKRKKAKGPNPLSCKKKKNEDKKPAAKNKEGDESAET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014474`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_014474`
Location	Chr03:49991307-49992574 (+)
Description	Similar to UTP23: rRNA-processing protein UTP23 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014474` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000447 endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000472 endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000480 endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006364 rRNA processing Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005739 mitochondrion Cellular Component GO:0032040 small-subunit processome Cellular Component GO:0003723 RNA binding Molecular Function GO:0003730 mRNA 3'-UTR binding Molecular Function GO:0004540 RNA nuclease activity Molecular Function
KEGG gene cross-reference	bta:534858 hsa:84294 mmu:78581 sce:YOR004W spo:2539158 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.927

Rank 1 · LXL04_014474 · OH-1004

Cytoplasm0.103

Rank 2 · LXL04_014474 · OH-1004

Cell membrane0.026

Rank 3 · LXL04_014474 · OH-1004

Endoplasmic reticulum0.020

Rank 4 · LXL04_014474 · OH-1004

Extracellular0.015

Rank 5 · LXL04_014474 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04900.19Fcf153-149 aa

PF24779.2UTP23_sensor224-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014474	`PF04900.19`	Fcf1	53	149	1.6e-27	96.5
LXL04_014474	`PF24779.2`	UTP23_sensor	224	241	9.1e-08	32.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card