TkA02G417800 | RubberDandelionOmics

Gene overview

TkA02G417800

Reference: TK1151 Chr: Chr02 Coordinates: 106197899-106205165 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3617 bp · TkA02G417800|TK1151|cDNA

TGAGAGTCGAGACAGAGGCAGTAAAATACACTAGATCGGCTTTAAACTCGGTGGGTGGGAAAAGATTTATGGTAAAATATATATTTATAATTAGGCACAAAATCAACGAACAAAAGGGAAAGAGTTTCGTGGCTGTTTCTCTCTCTTCTTCGTTTCTACTACGCGAAAGATCCCCTCGAATCGAGAAAGTGAGTGAGGATCATCATCCTTTGTTTTGATCCTCTGATTTTATGAAACGGTTTACTCATTATCGTCGCGTT...

CDS

Download CDS FASTA

2997 bp · TkA02G417800|TK1151|CDS

ATGCTGTCCCTACAGACCGATCCGAGACAAGCTCAGCAACAGCAATTCCAGCAGCAGCAGCAGCAGCAGCAGCAGTTGTTGCAGCAGGCTGTTAGGGCTTCTTATAATAATGGCGATCATCACCGTGAATCTTCTTTTGTCCTGTCAACGGAAATTGATCCTTCATCGGCTAACGTTAGCCTTAAACTGTCGCAAGGACTTGAAATTCGTGAAGCCGATGAAGATATGCTCATGTCCCTTGCTCATCAGAAGTACAAGTC...

Protein

Download Protein FASTA

998 aa · TkA02G417800|TK1151|PROTEIN

MLSLQTDPRQAQQQQFQQQQQQQQQLLQQAVRASYNNGDHHRESSFVLSTEIDPSSANVSLKLSQGLEIREADEDMLMSLAHQKYKSGDFRLALDHSKAVYDRNPLRTDNLLLMGAIYYQLHDFDMCIAKNEEALRIDRNFAECYGNMANAWKEKGNIDVAIRYYLIAIELRPNFADAWSNLGSAYMRKGRLTEAAQCCRQALSLNPRLVDAHSNLGNLMKAQGLVQEAYNCYVEALRIQPTFAIAWSNLAGLFMESGDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G417800`
TK1151 ID	TkA02G417800
OH-1004 ID	LXL04_014508
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 37.275 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G417800

Location Chr02:106197899-106205165 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04240`	O-linked N-acetylglucosamine transferase (OGT) that mediates O-glycosylation of capsid protein (CP) of virus in case of infection by Plum pox virus.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014508 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000423 mitophagy Biological Process

GO:0000432 positive regulation of transcription from RNA polymerase II promoter by glucose Biological Process

GO:0001933 negative regulation of protein phosphorylation Biological Process

GO:0001934 positive regulation of protein phosphorylation Biological Process

GO:0002181 cytoplasmic translation Biological Process

GO:0006041 glucosamine metabolic process Biological Process

GO:0006110 regulation of glycolytic process Biological Process

GO:0006111 regulation of gluconeogenesis Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006493 protein O-linked glycosylation Biological Process

KEGG gene cross-reference

ath:AT3G04240

mmu:108155

ocu:100354727

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.566

Rank 1 · TkA02G417800 · TK1151

Nucleus0.251

Rank 2 · TkA02G417800 · TK1151

Cell membrane0.216

Rank 3 · TkA02G417800 · TK1151

Golgi apparatus0.131

Rank 4 · TkA02G417800 · TK1151

Lysosome / Vacuole0.102

Rank 5 · TkA02G417800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24575TPR_Slam11-33 aa

PF29814TPR_Myxo12-35 aa

PF31146MIT_ATG3814-38 aa

PF21033RMD1-315-40 aa

PF23914TPR_CcmH_CycH23-95 aa

PF13414TPR_1151-63 aa

PF23558TPR_P4H61-105 aa

PF13429TPR_1562-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G417800	`PF24575`	TPR_Slam	11	33	1.9e-14	54.6
TkA02G417800	`PF29814`	TPR_Myxo	12	35	0.016	16.3
TkA02G417800	`PF31146`	MIT_ATG38	14	38	0.053	14.5
TkA02G417800	`PF21033`	RMD1-3	15	40	5.7e-20	72.2
TkA02G417800	`PF23914`	TPR_CcmH_CycH	23	95	2.3e-14	54.3
TkA02G417800	`PF13414`	TPR_11	51	63	3.4e-81	267.4
TkA02G417800	`PF23558`	TPR_P4H	61	105	8.2e-05	23.4
TkA02G417800	`PF13429`	TPR_15	62	175	1.2e-06	28.9
TkA02G417800	`PF27626`	CNOT10_TPR	62	121	3.6e-05	24.2
TkA02G417800	`PF14561`	TPR_20	63	95	5.6	8.1
TkA02G417800	`PF23914`	TPR_CcmH_CycH	69	130	2.3e-14	54.3
TkA02G417800	`PF29407`	CFAP70_TPR_C	73	275	2.2e-32	113.3
TkA02G417800	`PF12895`	ANAPC3	73	129	1.1e-05	26.3
TkA02G417800	`PF14863`	Alkyl_sulf_dimr	73	109	0.33	12.1
TkA02G417800	`PF00515`	TPR_1	77	96	1.9e-92	300.4
TkA02G417800	`PF13428`	TPR_14	77	115	1.5e-35	118.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M8Y0`	Arabidopsis thaliana	sp\|Q9M8Y0\|SEC_ARATH Probable UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase SEC	87.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card