TkA02G406660 | RubberDandelionOmics

Gene overview

TkA02G406660

Reference: TK1151 Chr: Chr02 Coordinates: 103388832-103389909 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

690 bp · TkA02G406660|TK1151|cDNA

GATCTCTCTCCCTCTCGATTCGCGTTTTGGATTCGAATAGAGATAAAAACGCACAGTTGTTTGGATTGTATTTCACAATTACTCGAAAAACAGTAGTTGTTTGTGAAGATGCCGATAGAGATGCCAAAGGGGTTACCATTCTCGGTGGACACATGGACGCCATCTTCAAACAGTAAGAGACACCATTTTCTAACACACGCCCACAAAGATCATTCACAAGGAATTTCCACTCACTCTTCATTTCCAATTTACGCTACCCG...

CDS

Download CDS FASTA

582 bp · TkA02G406660|TK1151|CDS

ATGCCGATAGAGATGCCAAAGGGGTTACCATTCTCGGTGGACACATGGACGCCATCTTCAAACAGTAAGAGACACCATTTTCTAACACACGCCCACAAAGATCATTCACAAGGAATTTCCACTCACTCTTCATTTCCAATTTACGCTACCCGTCTCACAAAATCCCTCACTCTCAACTACTACCCGCAGCTTAATGAGTCGTTATTCGTGGATATTGAGATTGATCAGCCAATTGCTATTAATGATCCCATTGAAACTTT...

Protein

Download Protein FASTA

194 aa · TkA02G406660|TK1151|PROTEIN

MPIEMPKGLPFSVDTWTPSSNSKRHHFLTHAHKDHSQGISTHSSFPIYATRLTKSLTLNYYPQLNESLFVDIEIDQPIAINDPIETFTVTAFDANHCPGAVMFLFEGTFGNILHTGDCRLTPECLQKLPEKYLGKTSREPKCRLDYVFLDCTFATFSSKMPSKHLAIRQVIDCIWKHPEAQVVYLTCDLLGQED

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G406660`
TK1151 ID	TkA02G406660
OH-1004 ID	LXL04_014648
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 41.365 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G406660`
Location	Chr02:103388832-103389909 (+)
Description	Similar to DCLRE1B: 5' exonuclease Apollo
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014648` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0006303 double-strand break repair via nonhomologous end joining Biological Process GO:0010833 telomere maintenance via telomere lengthening Biological Process GO:0016233 telomere capping Biological Process GO:0031627 telomeric loop formation Biological Process GO:0031848 protection from non-homologous end joining at telomere Biological Process GO:0031860 telomeric 3' overhang formation Biological Process GO:0036297 interstrand cross-link repair Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component
KEGG gene cross-reference	gga:428269 hsa:64858 mmu:140917 rno:310745 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.535

Rank 1 · TkA02G406660 · TK1151

Nucleus0.448

Rank 2 · TkA02G406660 · TK1151

Mitochondrion0.117

Rank 3 · TkA02G406660 · TK1151

Cell membrane0.059

Rank 4 · TkA02G406660 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA02G406660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23023Anti-Pycsar_Apyc118-65 aa

PF12706Lactamase_B_227-181 aa

PF23023Anti-Pycsar_Apyc184-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G406660	`PF23023`	Anti-Pycsar_Apyc1	18	65	0.0016	18.9
TkA02G406660	`PF12706`	Lactamase_B_2	27	181	1.5e-07	31.9
TkA02G406660	`PF23023`	Anti-Pycsar_Apyc1	84	132	0.0016	18.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card