TkA02G406000 | RubberDandelionOmics

Gene overview

TkA02G406000

Reference: TK1151 Chr: Chr02 Coordinates: 103179056-103181660 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1355 bp · TkA02G406000|TK1151|cDNA

ATTTAGATAGTAAACCACATGACCACTTTTTAATCCATCTTTGCTTTCAAACCGTCCCTCTTTCGTGATCACGGCAGTTGCTGCTTCGATTCTTTCAGTTACTGGTTGATTTCTCTGTTATAATCGAGTTGGTTGTTCCAAAACCAACTACTAATTCTTCCGTGATCTTAGAGCATGAATTGGCGCGAGTTATCGTTCTTACAGTTTGTTAAACAAGAAATTTTCTACTGCGAGTTTGATAACAATTCATGATTGGAATG...

CDS

Download CDS FASTA

909 bp · TkA02G406000|TK1151|CDS

ATGATTGGAATGAAAATGGAGTTATTACATGGAAGCATGATCACTCAGTTCAAAGCTCGACAGCCAATTTTGATCTTCTCCGAGCGCACTAAGAAACAAGATTCTCTTCTTGTCGTAAACCTCTTTAGGGAGAATTTCCCAATTTCATACACCCGTTGCAGAACCCTTGAGAGCCATTGGGATAATACTCAAAGCATTCGACACCCAGCTGTTTCCAGTAACGATGACTCAAAGGTGCCTGAGTTAATCTTCAATCGACT...

Protein

Download Protein FASTA

302 aa · TkA02G406000|TK1151|PROTEIN

MIGMKMELLHGSMITQFKARQPILIFSERTKKQDSLLVVNLFRENFPISYTRCRTLESHWDNTQSIRHPAVSSNDDSKVPELIFNRLQLSDEEYVDMQRRSFGHYIAREAVLNEEYWMAAWMRAEAHWEASSNKRHALNFKMKYADQEYKALKKRCSGQDGNLLQCFCLVAVKKEVKGVKRTVLSSIVGTMDLSIRQYLQGETYPGEVKRQSGVLASKQAFDAHKYAYISNVVVALYARRRGIALNMLHLAVDMATSKGM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G406000`
TK1151 ID	TkA02G406000
OH-1004 ID	LXL04_014662
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G406000

Location Chr02:103179056-103181660 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g06025`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA), with a large spectrum of modified N-termini, including methionine, alanine, serine, threonine and to a lower extent valine as substrates, and epsilon-lysine acetylation (KA).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014662 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0004596 protein-N-terminal amino-acid acetyltransferase activity Molecular Function

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G06025

ath:AT4G28030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.959

Rank 1 · TkA02G406000 · TK1151

Nucleus0.047

Rank 2 · TkA02G406000 · TK1151

Mitochondrion0.039

Rank 3 · TkA02G406000 · TK1151

Cytoplasm0.030

Rank 4 · TkA02G406000 · TK1151

Peroxisome0.015

Rank 5 · TkA02G406000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26466DNA_primase_lrg_N70-126 aa

PF13302Acetyltransf_382-136 aa

PF26466DNA_primase_lrg_N143-162 aa

PF13673Acetyltransf_10208-301 aa

PF13420Acetyltransf_4213-287 aa

PF00583Acetyltransf_1216-283 aa

PF13508Acetyltransf_7224-284 aa

PF08445FR47225-287 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G406000	`PF26466`	DNA_primase_lrg_N	70	126	0.088	13.3
TkA02G406000	`PF13302`	Acetyltransf_3	82	136	0.0027	19.1
TkA02G406000	`PF26466`	DNA_primase_lrg_N	143	162	0.088	13.3
TkA02G406000	`PF13673`	Acetyltransf_10	208	301	2.6e-06	28.2
TkA02G406000	`PF13420`	Acetyltransf_4	213	287	0.0063	17.3
TkA02G406000	`PF00583`	Acetyltransf_1	216	283	3.3e-10	41.0
TkA02G406000	`PF13508`	Acetyltransf_7	224	284	6.9e-05	23.9
TkA02G406000	`PF08445`	FR47	225	287	6.6e-05	23.5
TkA02G406000	`PF13302`	Acetyltransf_3	238	284	0.0027	19.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUT5`	Arabidopsis thaliana	sp\|Q8GUT5\|GNAT6_ARATH GCN5-related N-acetyltransferase 6, chloroplastic	51.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card