LXL04_014662 | RubberDandelionOmics

Gene overview

LXL04_014662

Reference: OH-1004 Chr: Chr03 Coordinates: 54534785-54536943 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

915 bp · LXL04_014662|LXL04_014662|OH1004|cDNA

ATGATTGGAATGAAAATGGAGTTATTACATGGAAGCATGATCACTCAGTTCAAAGCTCGACAGCCAATTTTGATCTTCTCCGAGCGCACTAAGAAACAAGATTCTCTTCTTGTCGTAAACCTCTTTAGGGAGAATTTCCCAATTTCATACACCCGTTGCAGAACCCTTGAGAGCCATTGGGATAATACTCAAAGCATTCGACACCCAGCTGTTTCCAGTAACGATGACTCAAAGGTGCCTGAGTTAATCTTCAATCGACT...

CDS

Download CDS FASTA

915 bp · LXL04_014662|LXL04_014662|OH1004|CDS

ATGATTGGAATGAAAATGGAGTTATTACATGGAAGCATGATCACTCAGTTCAAAGCTCGACAGCCAATTTTGATCTTCTCCGAGCGCACTAAGAAACAAGATTCTCTTCTTGTCGTAAACCTCTTTAGGGAGAATTTCCCAATTTCATACACCCGTTGCAGAACCCTTGAGAGCCATTGGGATAATACTCAAAGCATTCGACACCCAGCTGTTTCCAGTAACGATGACTCAAAGGTGCCTGAGTTAATCTTCAATCGACT...

Protein

Download Protein FASTA

304 aa · LXL04_014662|LXL04_014662|OH1004|PROTEIN

MIGMKMELLHGSMITQFKARQPILIFSERTKKQDSLLVVNLFRENFPISYTRCRTLESHWDNTQSIRHPAVSSNDDSKVPELIFNRLQLSDEEYVDMQRRSFGHYIAREAVLNEEYWMAAWMRAEAHWEASSNKSPRHALNFKMKYADQEYKALKKRCSGQDGNLLQCFCLVAVKKEVKGVKRTVLSSIVGTMDLSIRQYLQGETYPGEVKRQSGVLASKQAFDAHKYAYISNVVVALYARRRGIALNMLHLAVDMATSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014662`
TK1151 ID	TkA02G406000
OH-1004 ID	LXL04_014662
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014662

Location Chr03:54534785-54536943 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g06025`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA), with a large spectrum of modified N-termini, including methionine, alanine, serine, threonine and to a lower extent valine as substrates, and epsilon-lysine acetylation (KA).	No verified direct reference in this release
`At4g28030`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA), with a large spectrum of modified N-termini, including methionine, alanine, serine, threonine and to a lower extent valine and proline as substrates, and epsilon-lysine acetylation (KA).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014662 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0004596 protein-N-terminal amino-acid acetyltransferase activity Molecular Function

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G06025

ath:AT4G28030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.959

Rank 1 · LXL04_014662 · OH-1004

Nucleus0.048

Rank 2 · LXL04_014662 · OH-1004

Mitochondrion0.038

Rank 3 · LXL04_014662 · OH-1004

Cytoplasm0.030

Rank 4 · LXL04_014662 · OH-1004

Cell membrane0.015

Rank 5 · LXL04_014662 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13673.14Acetyltransf_10210-303 aa

PF00583.32Acetyltransf_1218-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014662	`PF13673.14`	Acetyltransf_10	210	303	2.7e-06	28.1
LXL04_014662	`PF00583.32`	Acetyltransf_1	218	285	3.3e-10	41.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUT5`	Arabidopsis thaliana	GCN5-related N-acetyltransferase 6, chloroplastic	50.943%	Swiss-Prot	moderate database homology
`Q94AC8`	Arabidopsis thaliana	GCN5-related N-acetyltransferase 7, chloroplastic	27.354%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card