TkA02G383140 | RubberDandelionOmics

Gene overview

TkA02G383140

Reference: TK1151 Chr: Chr02 Coordinates: 97385570-97390196 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3195 bp · TkA02G383140|TK1151|cDNA

GTGGTTTTGGTCCAAAATGTTTGGGTGGTGCACTGATGGTCCAAAATTGGATATCGTGTACGGTTTGGTCCCTACAGTTTATATTTTCGTTTGGTTCTGATCCACACCCAACCTAAAATGACTAATATGTCCTTTAAATAACTATATTTTGGATTTTTTTAATTTACTTTCTTATTCTTTTGATAAAAATAAATCAAAAATAAATTTCATTCACTCTCTCTACCTCTCTCGTTCGACTCTTTTTCTCTCTCTCTCTCTCT...

CDS

Download CDS FASTA

1014 bp · TkA02G383140|TK1151|CDS

ATGACGACGGTCGTGCCTACATCGGAGGAGGATCCCATCCTCTCTGTCTTTCGTTTTACCGCCGAGATGTCCTGGGCTGAAGCCGGTCCTGAGGTAGCTGAACCACGAGTTACTAGTTTATGCTTGGAGGCTCAAGAATGCATGATTGCTGGCAGATGGTTCGATTTGGCTTCGCTGATGCTTACTTCGGCTGAGTTGGCTAAAGAGTCTGCTAAAAATCAAGACCGCTGGCTTCTAGTAAACTTGCAATCTACCAGGGA...

Protein

Download Protein FASTA

337 aa · TkA02G383140|TK1151|PROTEIN

MTTVVPTSEEDPILSVFRFTAEMSWAEAGPEVAEPRVTSLCLEAQECMIAGRWFDLASLMLTSAELAKESAKNQDRWLLVNLQSTREFSSHMLNRDTWANEAVSHTIMSNFIFWQVCDDTEDGSKIKTYYKLDSVPVTLVIDPVTGQKMRLWRGMIEPENLLEDLLQFMDGSPKNHHISFIISAYHTNVHEKTLRPHLPKSKPCQGHKKRDKCESGYNEKSVEEPLKDLNGDIETEKKVPESEKRSYPVLLEEPKGDRNV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G383140`
TK1151 ID	TkA02G383140
OH-1004 ID	LXL04_014932
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G383140

Location Chr02:97385570-97390196 (-)

Description Similar to PUX7: Plant UBX domain-containing protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14570`	Acts as a bridge between CDC48A and ubiquitin, suggesting a role in targeted protein degradation.	Functional characterization of the plant ubiquitin regulatory X (UBX) domain-containing protein AtPUX7 in Arabidopsis thaliana.2013 · DOI: 10.1016/j.gene.2013.05.056
`At4g14250`	Putative plant UBX domain-containing protein 14.	No verified direct reference in this release
`At4g14245`	Plant UBX domain-containing protein 16.	No verified direct reference in this release
`At1g59550`	Putative plant UBX domain-containing protein 15.	No verified direct reference in this release
`At3g23605`	Plant UBX domain-containing protein 12.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014932 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0030674 protein-macromolecule adaptor activity Molecular Function

GO:0043130 ubiquitin binding Molecular Function

KEGG gene cross-reference

ath:AT1G14570

ath:AT1G59550

spo:2541532

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.534

Rank 1 · TkA02G383140 · TK1151

Nucleus0.359

Rank 2 · TkA02G383140 · TK1151

Cell membrane0.103

Rank 3 · TkA02G383140 · TK1151

Mitochondrion0.092

Rank 4 · TkA02G383140 · TK1151

Endoplasmic reticulum0.085

Rank 5 · TkA02G383140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13899Thioredoxin_763-143 aa

PF13098Thioredoxin_267-164 aa

PF00789UBX261-316 aa

PF13899Thioredoxin_7273-286 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G383140	`PF13899`	Thioredoxin_7	63	143	1.2e-13	51.7
TkA02G383140	`PF13098`	Thioredoxin_2	67	164	4.4e-05	24.5
TkA02G383140	`PF00789`	UBX	261	316	3.2e-08	34.4
TkA02G383140	`PF13899`	Thioredoxin_7	273	286	1.2e-13	51.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94JZ8`	Arabidopsis thaliana	sp\|Q94JZ8\|PUX7_ARATH Plant UBX domain-containing protein 7	52.200%	Swiss-Prot	High
`P0DKI4`	Arabidopsis thaliana	sp\|P0DKI4\|PUX14_ARATH Putative plant UBX domain-containing protein 14	47.100%	Swiss-Prot	Medium
`P0DKI5`	Arabidopsis thaliana	sp\|P0DKI5\|PUX16_ARATH Plant UBX domain-containing protein 16	41.900%	Swiss-Prot	Medium
`Q94HV8`	Arabidopsis thaliana	sp\|Q94HV8\|PUX15_ARATH Putative plant UBX domain-containing protein 15	40.300%	Swiss-Prot	Medium
`Q9LUG7`	Arabidopsis thaliana	sp\|Q9LUG7\|PUX12_ARATH Plant UBX domain-containing protein 12	50.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card