RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G382240
Reference: TK1151 Chr: Chr02 Coordinates: 97182680-97189941 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2059 bp · TkA02G382240|TK1151|cDNA

TTTTCATCGGATACATTCGTATCATTCATAAGCGACCTCCTCTGAAACACATAAGCGAGAGAGAAGCGCGAATGCCGAGTTTGAGTGGCTCCGATTCGAGAAGGGAATCTGGAATTACGGGGATGTGTTTGTGTCACCAGAAACTTGTGGACAAATAACTTCAGCGAATTTTATGGGAATTTCAACATTCGTGGATGAGATTCTTTGGAGGTTTCAACGACATAATCATCTGTCTTCTTCTGTTACTTCCACTAACCCCA...

CDS

Download CDS FASTA

1677 bp · TkA02G382240|TK1151|CDS

ATGGGAATTTCAACATTCGTGGATGAGATTCTTTGGAGGTTTCAACGACATAATCATCTGTCTTCTTCTGTTACTTCCACTAACCCCAATCCCGTTGTTCTGAATCCCGATTATGAACCCAAACCATCGTCATCATTATCCACAATTGTTCAAGGGTTCCATCTTCCTGCACTTGAGAATACCAGAGTTCCAAAACGCATCGCTTTCCCACCAATGGATCCTATGAAAAGGCTGGAAAGAGAGTTCTTCACGGAATATGG...

Protein

Download Protein FASTA

558 aa · TkA02G382240|TK1151|PROTEIN

MGISTFVDEILWRFQRHNHLSSSVTSTNPNPVVLNPDYEPKPSSSLSTIVQGFHLPALENTRVPKRIAFPPMDPMKRLEREFFTEYGEAGRYEVQEVVGKGSYGVVGSATDKHTGDRVAIKKINDVFEHVSDATRILREIKLLRLLRHPDIVEIKHIMLPPSRREFRDIYVVFELMESDLHQVIRANDDLTPEHYQFFLYQLLRGLKYIHSANVFHRDLKPKNILANADCKLKICDFGLARVSFNDAPSAIFWTDYVATR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G382240
TK1151 IDTkA02G382240
OH-1004 IDLXL04_014939
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)96.500
Protein coverage (%)TK1151 79.928 / OH-1004 95.851
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G382240
LocationChr02:97182680-97189941 (-)
DescriptionSimilar to MPK9: Mitogen-activated protein kinase 9
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g18040 Mitogen-activated protein kinase 9. No verified direct reference in this release
At1g18150 MKK3-MPK8 and CAMs-MPK8 modules negatively regulates ROS accumulation through controlling expression of the RBOHD gene during wounding.
Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis.2011 · DOI: 10.1016/j.molcel.2011.02.029
At1g73670 Mitogen-activated protein kinase 15. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os06g0708000 May be involved in defense signaling pathway.
BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor.2003 · DOI: 10.1104/pp.103.023176
Os05g0576800 Mitogen-activated protein kinase 17. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014939 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000302 response to reactive oxygen species Biological Process
GO:0007165 signal transduction Biological Process
GO:0009611 response to wounding Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:0035556 intracellular signal transduction Biological Process
GO:0042542 response to hydrogen peroxide Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005829 cytosol Cellular Component
GO:0004674 protein serine/threonine kinase activity Molecular Function
KEGG gene cross-reference
ath:AT1G18150
ath:AT1G73670
ath:AT3G18040
dosa:Os05g0576800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.626
Rank 1 · TkA02G382240 · TK1151
Nucleus0.413
Rank 2 · TkA02G382240 · TK1151
Cell membrane0.100
Rank 3 · TkA02G382240 · TK1151
Golgi apparatus0.045
Rank 4 · TkA02G382240 · TK1151
Mitochondrion0.043
Rank 5 · TkA02G382240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase92-383 aa
PF07714PK_Tyr_Ser-Thr93-308 aa
PF14531Kinase-like95-123 aa
PF03109ABC198-123 aa
PF06293Kdo125-231 aa
PF14531Kinase-like199-286 aa
PF03109ABC1207-241 aa
PF12330Haspin_kinase216-255 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G382240PF00069Pkinase923835.5e-66223.4
TkA02G382240PF07714PK_Tyr_Ser-Thr933081.4e-31110.4
TkA02G382240PF14531Kinase-like951230.05813.4
TkA02G382240PF03109ABC1981230.02414.5
TkA02G382240PF06293Kdo1252310.0001522.0
TkA02G382240PF14531Kinase-like1992860.05813.4
TkA02G382240PF03109ABC12072410.02414.5
TkA02G382240PF12330Haspin_kinase2162550.00816.0
TkA02G382240PF12330Haspin_kinase4024150.00816.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LV37Arabidopsis thalianasp|Q9LV37|MPK9_ARATH Mitogen-activated protein kinase 984.100%Swiss-ProtHigh
Q9LM33Arabidopsis thalianasp|Q9LM33|MPK8_ARATH Mitogen-activated protein kinase 881.100%Swiss-ProtHigh
Q9C9U4Arabidopsis thalianasp|Q9C9U4|MPK15_ARATH Mitogen-activated protein kinase 1581.700%Swiss-ProtHigh
Q5Z9J0Oryza sativa subsp. japonicasp|Q5Z9J0|MPK12_ORYSJ Mitogen-activated protein kinase 1276.500%Swiss-ProtHigh
Q6L5F7Oryza sativa subsp. japonicasp|Q6L5F7|MPK17_ORYSJ Mitogen-activated protein kinase 1774.900%Swiss-ProtHigh

JBrowse

View in Genome Browser