TkA02G345320 | RubberDandelionOmics

Gene overview

TkA02G345320

Reference: TK1151 Chr: Chr02 Coordinates: 87693613-87695948 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1527 bp · TkA02G345320|TK1151|cDNA

ATGCATGCTCGATTCACAAAACTTGAATCTTGTTTATCTGATACTGAATCTGCACTTTCCACCTCAAAATCCTGTCTACAACATGCTGAAGAAACCGTAAATGCACTATCGTACCAAAACGATGAACTGAGAAGTCTTTTAGAGGAGATTTATCATAAAAAGTCAGAAACTGAAGAGCAACTGGAAGAACAAAAAGAAATTGTGAAATCTTTAGAAAAGGAAATTCATAATGGAGCTTCTTCAGTTCAAGAACAGTTCTT...

CDS

Download CDS FASTA

1527 bp · TkA02G345320|TK1151|CDS

ATGCATGCTCGATTCACAAAACTTGAATCTTGTTTATCTGATACTGAATCTGCACTTTCCACCTCAAAATCCTGTCTACAACATGCTGAAGAAACCGTAAATGCACTATCGTACCAAAACGATGAACTGAGAAGTCTTTTAGAGGAGATTTATCATAAAAAGTCAGAAACTGAAGAGCAACTGGAAGAACAAAAAGAAATTGTGAAATCTTTAGAAAAGGAAATTCATAATGGAGCTTCTTCAGTTCAAGAACAGTTCTT...

Protein

Download Protein FASTA

508 aa · TkA02G345320|TK1151|PROTEIN

MHARFTKLESCLSDTESALSTSKSCLQHAEETVNALSYQNDELRSLLEEIYHKKSETEEQLEEQKEIVKSLEKEIHNGASSVQEQFLFSLEGITDDLKRVSSERDQLYEQVSSLQEKLEMAYALADENEAIAVEAHQVNEMEEEIKRQHKIRDSLEVELQSLNQRLLSVESLQDSDNSNLDQYKYQISRKLQERIKDLEEERTEQANEMKQCKEYMSEVVIHAEAQAFQYQQKYKSLEAMVSSMKIDTSKCMSDTQEKSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G345320`
TK1151 ID	TkA02G345320
OH-1004 ID	LXL04_015348
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	92.000
Protein coverage (%)	TK1151 94.291 / OH-1004 27.205 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G345320

Location Chr02:87693613-87695948 (+)

Description Similar to KIN12C: Kinesin-like protein KIN-12C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17360`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034 Tangled localization at the cortical division site of plant cells occurs by several mechanisms.2011 · DOI: 10.1242/jcs.073676
`At3g19050`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0638000`	Kinesin-like protein KIN-12E.	No verified direct reference in this release
`Os12g0590500`	Kinesin-like protein KIN-12F.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015348 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007018 microtubule-based movement Biological Process

GO:0005874 microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0032153 cell division site Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT3G17360

dosa:Os07g0638000

dosa:Os12g0590500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.632

Rank 1 · TkA02G345320 · TK1151

Nucleus0.247

Rank 2 · TkA02G345320 · TK1151

Golgi apparatus0.133

Rank 3 · TkA02G345320 · TK1151

Cell membrane0.092

Rank 4 · TkA02G345320 · TK1151

Lysosome / Vacuole0.054

Rank 5 · TkA02G345320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03265DNase_II23-40 aa

PF06818Fez148-177 aa

PF03265DNase_II108-285 aa

PF06818Fez1189-259 aa

PF06818Fez1282-317 aa

PF06818Fez1348-473 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G345320	`PF03265`	DNase_II	23	40	0.96	9.3
TkA02G345320	`PF06818`	Fez1	48	177	3.3	8.8
TkA02G345320	`PF03265`	DNase_II	108	285	0.96	9.3
TkA02G345320	`PF06818`	Fez1	189	259	3.3	8.8
TkA02G345320	`PF06818`	Fez1	282	317	3.3	8.8
TkA02G345320	`PF06818`	Fez1	348	473	3.3	8.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q27IK7`	Arabidopsis thaliana	sp\|Q27IK7\|KN12C_ARATH Kinesin-like protein KIN-12C	40.600%	Swiss-Prot	Medium
`Q27IK6`	Arabidopsis thaliana	sp\|Q27IK6\|KN12D_ARATH Kinesin-like protein KIN-12D	39.200%	Swiss-Prot	Low
`B9FUF9`	Oryza sativa subsp. japonica	sp\|B9FUF9\|KN12E_ORYSJ Kinesin-like protein KIN-12E	34.300%	Swiss-Prot	Medium
`B9GE13`	Oryza sativa subsp. japonica	sp\|B9GE13\|KN12F_ORYSJ Kinesin-like protein KIN-12F	32.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card