TkA02G243100 | RubberDandelionOmics

Gene overview

TkA02G243100

Reference: TK1151 Chr: Chr02 Coordinates: 62431239-62432356 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

955 bp · TkA02G243100|TK1151|cDNA

CACAAACATGTAACAAGTTGTGCTGCTATGCTCTGATAAATGATATATTAAATTACAAATTTATGATAGATATTATTCATATTATCTTAATGGATTTGAATGTTGTGCAGATTAAACGCAGATCAAACTCTATACAATGTCGATTCCGTGCAAAGGATTTTGGAATATTTCCTGATGCATGAACATCAACAACAAACACAAAGTCATGAGAAAGCAAAATTAGTAAATTGCTGGATAATTATCTTGCAGAAATAGCAGGT...

CDS

Download CDS FASTA

501 bp · TkA02G243100|TK1151|CDS

AACCCTTACAAAGTTGGAATTGGCTTTCAGGCCTCCTATTTATTTTGTAACCAGGCACATCCATCTCTCTCTGAGCATGACAGAAGAAGATTATGTAGAGCCATGGACTGTCACAAGCTTTCAGTTGATGCATGCACGCATGCCGCAAGAAATGACCGACTACCTTTAAGAACAGTTATGCAGGTATTACTTGCGGAGCAACTAAAGATGAGGGATTCAATGCAACATAACCAGTGTGTAGTTAACACCGAGTATTCACA...

Protein

Download Protein FASTA

166 aa · TkA02G243100|TK1151|PROTEIN

NPYKVGIGFQASYLFCNQAHPSLSEHDRRRLCRAMDCHKLSVDACTHAARNDRLPLRTVMQVLLAEQLKMRDSMQHNQCVVNTEYSQCEDNYSSPKEEIKLLKKEVEKMMLLIKELQRNYTNLQQNCEKMKNKQNALSGWMLGCIRSKDPRYSMGNSMQMNLERKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G243100`
TK1151 ID	TkA02G243100
OH-1004 ID	LXL04_015905
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 75.904 / OH-1004 22.662 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G243100

Location Chr02:62431239-62432356 (+)

Description Similar to DOT3: BTB/POZ domain-containing protein DOT3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64330`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	Arabidopsis NPH3: A NPH1 photoreceptor-interacting protein essential for phototropism.1999 · DOI: 10.1126/science.286.5441.961 RPT2. A signal transducer of the phototropic response in Arabidopsis.2000 · DOI: 10.1105/tpc.12.2.225 RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin 1 in Arabidopsis thaliana.2004 · DOI: 10.1105/tpc.019901 PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism.2006 · DOI: 10.1073/pnas.0603799103 The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element that regulates leaf flattening and leaf positioning.2010 · DOI: 10.1104/pp.109.150441
`At5g10250`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release
`At1g30440`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g13600`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g66560`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0568200`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	The Rice COLEOPTILE PHOTOTROPISM1 gene encoding an ortholog of Arabidopsis NPH3 is required for phototropism of coleoptiles and lateral translocation of auxin.2005 · DOI: 10.1105/tpc.104.028357

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015905 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009904 chloroplast accumulation movement Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0010588 cotyledon vascular tissue pattern formation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048367 shoot system development Biological Process

GO:0080022 primary root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G30440

ath:AT5G10250

ath:AT5G13600

ath:AT5G66560

ath:AT5G67385

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.470

Rank 1 · TkA02G243100 · TK1151

Cytoplasm0.415

Rank 2 · TkA02G243100 · TK1151

Mitochondrion0.126

Rank 3 · TkA02G243100 · TK1151

Cell membrane0.077

Rank 4 · TkA02G243100 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA02G243100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06657Cep57_MT_bd17-36 aa

PF03000NPH318-45 aa

PF30756LUZP251-125 aa

PF16523betaPIX_CC61-135 aa

PF06005ZapB66-71 aa

PF07200Mod_r67-132 aa

PF11932DUF345069-139 aa

PF06657Cep57_MT_bd77-77 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G243100	`PF06657`	Cep57_MT_bd	17	36	2.2	9.5
TkA02G243100	`PF03000`	NPH3	18	45	7e-09	36.4
TkA02G243100	`PF30756`	LUZP2	51	125	0.011	15.9
TkA02G243100	`PF16523`	betaPIX_CC	61	135	0.034	14.8
TkA02G243100	`PF06005`	ZapB	66	71	0.024	15.8
TkA02G243100	`PF07200`	Mod_r	67	132	0.4	11.4
TkA02G243100	`PF11932`	DUF3450	69	139	0.0018	18.3
TkA02G243100	`PF06657`	Cep57_MT_bd	77	77	2.2	9.5
TkA02G243100	`PF03961`	FapA	81	138	0.37	11.1
TkA02G243100	`PF13094`	CENP-Q	85	134	0.023	15.6
TkA02G243100	`PF15136`	UPF0449	88	138	1.3	10.3
TkA02G243100	`PF06005`	ZapB	92	138	0.024	15.8
TkA02G243100	`PF06657`	Cep57_MT_bd	99	133	2.2	9.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMF5`	Arabidopsis thaliana	sp\|Q9FMF5\|RPT3_ARATH Root phototropism protein 3	36.500%	Swiss-Prot	Medium
`Q9LFU0`	Arabidopsis thaliana	sp\|Q9LFU0\|DOT3_ARATH BTB/POZ domain-containing protein DOT3	55.700%	Swiss-Prot	Low
`Q9S9Q9`	Arabidopsis thaliana	sp\|Q9S9Q9\|Y1044_ARATH BTB/POZ domain-containing protein At1g30440	60.000%	Swiss-Prot	Low
`Q9FNB3`	Arabidopsis thaliana	sp\|Q9FNB3\|Y5360_ARATH Putative BTB/POZ domain-containing protein At5g13600	56.100%	Swiss-Prot	Low
`Q94A73`	Arabidopsis thaliana	sp\|Q94A73\|Y5656_ARATH BTB/POZ domain-containing protein At5g66560	62.500%	Swiss-Prot	Low
`Q5KS50`	Oryza sativa subsp. japonica	sp\|Q5KS50\|NPH3_ORYSJ Coleoptile phototropism protein 1	37.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card