TkA02G241210 | RubberDandelionOmics

Gene overview

TkA02G241210

Reference: TK1151 Chr: Chr02 Coordinates: 62021920-62023117 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

612 bp · TkA02G241210|TK1151|cDNA

ATGCCACTTCTTCGTCAGATTGAGATTCGTTTGAAGGCTAACTGTGACAAGTTAGCTGATGCTTTTATTGATGACTTGGATTCATCAACAGGAAGTCAAAGTTCAAGTTCCAGGCTTCCAGAAAGGGTAAAGTTAATGATTGAGGAGATCGAAAGAGAAGAAACAGCTTTACGTGAAGATCTATATTCAGCTGACAGAAAGTTTGCAGAATATTACAGTGTATTGGAGCAGATACTTGGTGTGCTTATTAAGCTCGTGAA...

CDS

Download CDS FASTA

612 bp · TkA02G241210|TK1151|CDS

ATGCCACTTCTTCGTCAGATTGAGATTCGTTTGAAGGCTAACTGTGACAAGTTAGCTGATGCTTTTATTGATGACTTGGATTCATCAACAGGAAGTCAAAGTTCAAGTTCCAGGCTTCCAGAAAGGGTAAAGTTAATGATTGAGGAGATCGAAAGAGAAGAAACAGCTTTACGTGAAGATCTATATTCAGCTGACAGAAAGTTTGCAGAATATTACAGTGTATTGGAGCAGATACTTGGTGTGCTTATTAAGCTCGTGAA...

Protein

Download Protein FASTA

203 aa · TkA02G241210|TK1151|PROTEIN

MPLLRQIEIRLKANCDKLADAFIDDLDSSTGSQSSSSRLPERVKLMIEEIEREETALREDLYSADRKFAEYYSVLEQILGVLIKLVKDLKLQHQHKYDELQKTWLCKRCETMSAKLRVLEHILLLEAYTQESVPALHKIRNYLVEATEEASLAYNKAVTRLREYQGVDPHFDTIARQYQEIVKVRHKYFTRFLISFKINKLEH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G241210`
TK1151 ID	TkA02G241210
OH-1004 ID	LXL04_016362
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	79.800
Protein coverage (%)	TK1151 99.015 / OH-1004 50.242 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G241210

Location Chr02:62021920-62023117 (+)

Description Similar to AUG4: AUGMIN subunit 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50710`	Involved in microtubules reorganization during spindle and phragmoplast development.	Characterization of the Arabidopsis augmin complex uncovers its critical function in the assembly of the acentrosomal spindle and phragmoplast microtubule arrays.2012 · DOI: 10.1105/tpc.112.096610

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016362 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007098 centrosome cycle Biological Process

GO:0010968 regulation of microtubule nucleation Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051301 cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0005813 centrosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005876 spindle microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0070652 HAUS complex Cellular Component

GO:1990498 mitotic spindle microtubule Cellular Component

GO:0051011 microtubule minus-end binding Molecular Function

KEGG gene cross-reference

ath:AT1G50710

hsa:54930

mmu:219072

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.568

Rank 1 · TkA02G241210 · TK1151

Nucleus0.337

Rank 2 · TkA02G241210 · TK1151

Cell membrane0.089

Rank 3 · TkA02G241210 · TK1151

Mitochondrion0.070

Rank 4 · TkA02G241210 · TK1151

Golgi apparatus0.068

Rank 5 · TkA02G241210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14735HAUS43-183 aa

PF28695FGSG_1074538-170 aa

PF26756ShkE_N63-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G241210	`PF14735`	HAUS4	3	183	5.1e-64	216.9
TkA02G241210	`PF28695`	FGSG_10745	38	170	0.3	11.3
TkA02G241210	`PF26756`	ShkE_N	63	121	0.089	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYM3`	Arabidopsis thaliana	sp\|Q8GYM3\|AUG4_ARATH AUGMIN subunit 4	82.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card