TkA02G127200 | RubberDandelionOmics

Gene overview

TkA02G127200

Reference: TK1151 Chr: Chr02 Coordinates: 33018177-33019488 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

390 bp · TkA02G127200|TK1151|cDNA

ATGGCCTTCTTTCAGGTTCGAATTCCGGAACAGTTGATGGCGGCTTTCCCGATTCGGTTTAAAGAGGATTCAGATCTGGTTATCGCGAACGCCTTCTTTCGGGAGCTCGTGGACATCGAAAGTTCATTGAAGTGTGCTAGAGCACCGGCGTGCTACTGGTCACCGATTCCACCGGCAGAGTTGAGAGGAGAATCTACTCGTCTCATTTGCTTTAATCAGTTAGATCTTCCTGAATACTCAACAAAGGAACAACTTCAAGA...

CDS

Download CDS FASTA

390 bp · TkA02G127200|TK1151|CDS

ATGGCCTTCTTTCAGGTTCGAATTCCGGAACAGTTGATGGCGGCTTTCCCGATTCGGTTTAAAGAGGATTCAGATCTGGTTATCGCGAACGCCTTCTTTCGGGAGCTCGTGGACATCGAAAGTTCATTGAAGTGTGCTAGAGCACCGGCGTGCTACTGGTCACCGATTCCACCGGCAGAGTTGAGAGGAGAATCTACTCGTCTCATTTGCTTTAATCAGTTAGATCTTCCTGAATACTCAACAAAGGAACAACTTCAAGA...

Protein

Download Protein FASTA

129 aa · TkA02G127200|TK1151|PROTEIN

MAFFQVRIPEQLMAAFPIRFKEDSDLVIANAFFRELVDIESSLKCARAPACYWSPIPPAELRGESTRLICFNQLDLPEYSTKEQLQELIACNFFKPLISYVDVTAATNRADIFDPALMRRKIEFPHQQI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G127200`
TK1151 ID	TkA02G127200
OH-1004 ID	LXL04_016533
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G127200

Location Chr02:33018177-33019488 (-)

Description Similar to ARPC2B: Actin-related protein 2/3 complex subunit 2B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30825`	Functions as actin-binding component of the Arp2/3 complex which is involved in regulation of actin polymerization and together with an activating nucleation-promoting factor (NPF) mediates the formation of branched actin networks.	DISTORTED2 encodes an ARPC2 subunit of the putative Arabidopsis ARP2/3 complex.2004 · DOI: 10.1111/j.1365-313x.2004.02065.x Actin control over microtubules suggested by DISTORTED2 encoding the Arabidopsis ARPC2 subunit homolog.2004 · DOI: 10.1093/pcp/pch103

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016533 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007015 actin filament organization Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0030041 actin filament polymerization Biological Process

GO:0034314 Arp2/3 complex-mediated actin nucleation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005885 Arp2/3 protein complex Cellular Component

GO:0042995 cell projection Cellular Component

GO:0005200 structural constituent of cytoskeleton Molecular Function

GO:0051015 actin filament binding Molecular Function

KEGG gene cross-reference

ath:AT1G30825

ath:AT2G33385

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.353

Rank 1 · TkA02G127200 · TK1151

Cytoplasm0.317

Rank 2 · TkA02G127200 · TK1151

Mitochondrion0.165

Rank 3 · TkA02G127200 · TK1151

Plastid0.097

Rank 4 · TkA02G127200 · TK1151

Extracellular0.067

Rank 5 · TkA02G127200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04045P34-Arc12-64 aa

PF00632HECT70-88 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G127200	`PF04045`	P34-Arc	12	64	0.00025	21.6
TkA02G127200	`PF00632`	HECT	70	88	0.0024	18.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LGI3`	Arabidopsis thaliana	sp\|Q8LGI3\|ARC2A_ARATH Actin-related protein 2/3 complex subunit 2A	35.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card