TkA02G111600 | RubberDandelionOmics

Gene overview

TkA02G111600

Reference: TK1151 Chr: Chr02 Coordinates: 29235462-29240911 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2443 bp · TkA02G111600|TK1151|cDNA

CAAACACTTCACAGCTTTCAATCTATTCAAAATTTCATTTCTTTCAATTATTCCGACGGATTCCATCTATTTAGGAACGAATTATGCAAACCAAAAGCCTAAAGCGTTCTTCTAAACTAGAATCATCGGGTGTTTTGGTGTCTAATTTCTCTAATGTCCCAAATGTAATATAGGTCAGTTTGCGCCGTTTTCCAATTTCGTTCAGATGCGCGCCCAGTCGTCTCACTTCCGCTAATTTTCAAATTTCACTACCGGAGAAA...

CDS

Download CDS FASTA

2457 bp · TkA02G111600|TK1151|CDS

ATGCTTCCTTTCATGGATGCAGCTGCCATGGATGGGAACGATCTAGCTTCTGACCAAGTGATTGCTGAACTCATAGGCATGGGGTTTCAGATTTCAGAGGCTACAGAAGCCATTAAAGAAGTGGGTCCTTCAATTAACAATGCAGTTGATTTCATTTTGAATGCTAGCAGTAGAAATGGAGAAGCTTCTACTTCTAGCAAGAAACCTACTAGAAAAAAGGGGTTATCCACCACTGGAAAACAGTCAGGTGTGAGAATGCG...

Protein

Download Protein FASTA

818 aa · TkA02G111600|TK1151|PROTEIN

MLPFMDAAAMDGNDLASDQVIAELIGMGFQISEATEAIKEVGPSINNAVDFILNASSRNGEASTSSKKPTRKKGLSTTGKQSGVRMRQLSIMDHLQSASKPKANNTSVSRAFIEESIYSKEQEEDVGPDWELKANALLQKHFGYASLKRFQIEALSAWMAHKDCLVLAATGSGKSLCFQIPALLTRKVVVVISPLISLMHDQCLKLARHGVSACFLGSGQIDQSVEEKSMRGMYDIIYVCPETILRLIKRLENLAESRGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G111600`
TK1151 ID	TkA02G111600
OH-1004 ID	LXL04_016689
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.500
Protein coverage (%)	TK1151 99.144 / OH-1004 81.081 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G111600

Location Chr02:29235462-29240911 (+)

Description Similar to RECQSIM: ATP-dependent DNA helicase Q-like SIM

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g27680`	Plant specific, probable 3'-5' DNA helicase that may play a role in the repair of DNA.	Arabidopsis RecQsim, a plant-specific member of the RecQ helicase family, can suppress the MMS hypersensitivity of the yeast sgs1 mutant.2003 · DOI: 10.1023/a:1023968429220

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016689 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000729 DNA double-strand break processing Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0051259 protein complex oligomerization Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000400 four-way junction DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G35740

ath:AT5G27680

xla:373628

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.890

Rank 1 · TkA02G111600 · TK1151

Cytoplasm0.155

Rank 2 · TkA02G111600 · TK1151

Mitochondrion0.046

Rank 3 · TkA02G111600 · TK1151

Cell membrane0.023

Rank 4 · TkA02G111600 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA02G111600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22562UBA_719-56 aa

PF04851ResIII147-284 aa

PF00270DEAD149-319 aa

PF00271Helicase_C297-335 aa

PF05648PEX11390-466 aa

PF00270DEAD468-528 aa

PF00271Helicase_C468-565 aa

PF06862Utp25_C468-557 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G111600	`PF22562`	UBA_7	19	56	0.0012	19.5
TkA02G111600	`PF04851`	ResIII	147	284	5.4e-05	23.9
TkA02G111600	`PF00270`	DEAD	149	319	1.7e-26	93.6
TkA02G111600	`PF00271`	Helicase_C	297	335	1.8e-18	67.5
TkA02G111600	`PF05648`	PEX11	390	466	0.21	11.8
TkA02G111600	`PF00270`	DEAD	468	528	1.7e-26	93.6
TkA02G111600	`PF00271`	Helicase_C	468	565	1.8e-18	67.5
TkA02G111600	`PF06862`	Utp25_C	468	557	0.14	12.5
TkA02G111600	`PF10589`	NADH_4Fe-4S	578	613	0.15	12.7
TkA02G111600	`PF16124`	RecQ_Zn_bind	581	636	2.2e-09	38.6
TkA02G111600	`PF10589`	NADH_4Fe-4S	618	645	0.15	12.7
TkA02G111600	`PF06862`	Utp25_C	696	738	0.14	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FT69`	Arabidopsis thaliana	sp\|Q9FT69\|RQSIM_ARATH ATP-dependent DNA helicase Q-like SIM	51.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card