TkA02G109420 | RubberDandelionOmics

Gene overview

TkA02G109420

Reference: TK1151 Chr: Chr02 Coordinates: 28597490-28601650 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1916 bp · TkA02G109420|TK1151|cDNA

CCATCACCGCTTTCTTTGTTTTCCTCTCATGTCTATAAACCCAAATGAATTGTTATTATTTGTTATTATTATCTTCATCCCTTCTTTCGATATCTCAGATACACATGTCGGAACTCCCTCTTATTCCGGCCACTTGTTGATTTTTTCCGATCATAACAAGGATTGTTGAGGATATAGTGTATTACTATGGGGCGTTTCACATCCATGTTTAATGGGCTAACAAAGTCGTTTTCAACAACAAAGAAAGTGAAGAATTCTGG...

CDS

Download CDS FASTA

1068 bp · TkA02G109420|TK1151|CDS

ATGGGGCGTTTCACATCCATGTTTAATGGGCTAACAAAGTCGTTTTCAACAACAAAGAAAGTGAAGAATTCTGGGGACCATGGTGGAAAAGAGACGTCAGAATCCATGGTTAAAGATGCAAAGAAGAACGATTTGATCTTAAGATCTACCGGTAGTATTAACGTCCATAATTTAGCTTCTGTTTGCTCAAAAAGAGGCGAAAAGGGTGTGAATCAAGATTGTTGCATCGTATGGGAGGAATATGGAGGCCAGGAGGATAT...

Protein

Download Protein FASTA

355 aa · TkA02G109420|TK1151|PROTEIN

MGRFTSMFNGLTKSFSTTKKVKNSGDHGGKETSESMVKDAKKNDLILRSTGSINVHNLASVCSKRGEKGVNQDCCIVWEEYGGQEDMTFCGVFDGHGSWGHYVAKKVCESIPSSLLRDWQQEMLLEASLDDLESLKKLDKFHLWKNSFLKTCASVDQDLQECRKFDSFHSGTTALAVVKQGELLVIANVGDSRAVLATTGDDGCLVPVQVTIDFKPNLTHEEERIVECNGRVFCLEDEPGVHRLWRPDGETPGLAMSRAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G109420`
TK1151 ID	TkA02G109420
OH-1004 ID	LXL04_016709
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 99.718 / OH-1004 98.061 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G109420

Location Chr02:28597490-28601650 (-)

Description Similar to PPC6-7: Probable protein phosphatase 2C 73

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g27930`	Probable protein phosphatase 2C 73.	No verified direct reference in this release
`At3g05640`	Probable protein phosphatase 2C 34.	No verified direct reference in this release
`At3g16800`	Probable protein phosphatase 2C 41.	No verified direct reference in this release
`At3g02750`	Probable protein phosphatase 2C 33.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0358500`	Probable protein phosphatase 2C 48.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016709 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0006470 protein dephosphorylation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009819 drought recovery Biological Process

GO:0045926 negative regulation of growth Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT1G79630

ath:AT3G05640

ath:AT3G16800

ath:AT5G27930

dosa:Os05g0358500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.506

Rank 1 · TkA02G109420 · TK1151

Cytoplasm0.427

Rank 2 · TkA02G109420 · TK1151

Cell membrane0.123

Rank 3 · TkA02G109420 · TK1151

Endoplasmic reticulum0.067

Rank 4 · TkA02G109420 · TK1151

Mitochondrion0.067

Rank 5 · TkA02G109420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13672PP2C_268-306 aa

PF00481PP2C82-322 aa

PF07228SpoIIE164-199 aa

PF07228SpoIIE279-346 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G109420	`PF13672`	PP2C_2	68	306	6e-07	30.0
TkA02G109420	`PF00481`	PP2C	82	322	4.1e-41	142.1
TkA02G109420	`PF07228`	SpoIIE	164	199	0.1	13.2
TkA02G109420	`PF07228`	SpoIIE	279	346	0.1	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WRB2`	Arabidopsis thaliana	sp\|Q0WRB2\|P2C73_ARATH Probable protein phosphatase 2C 73	63.200%	Swiss-Prot	High
`Q9M9W9`	Arabidopsis thaliana	sp\|Q9M9W9\|P2C34_ARATH Probable protein phosphatase 2C 34	63.800%	Swiss-Prot	High
`Q9LRZ4`	Arabidopsis thaliana	sp\|Q9LRZ4\|P2C41_ARATH Probable protein phosphatase 2C 41	55.800%	Swiss-Prot	High
`Q9M8R7`	Arabidopsis thaliana	sp\|Q9M8R7\|P2C33_ARATH Probable protein phosphatase 2C 33	44.700%	Swiss-Prot	Medium
`Q6L482`	Oryza sativa subsp. japonica	sp\|Q6L482\|P2C48_ORYSJ Probable protein phosphatase 2C 48	56.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card