LXL04_016709 | RubberDandelionOmics

Gene overview

LXL04_016709

Reference: OH-1004 Chr: Chr03 Coordinates: 131958788-131960206 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1086 bp · LXL04_016709|LXL04_016709|OH1004|cDNA

ATGGGGCGTTTCACATCCATGTTTAATGGGCTAACAAAGTCTTTTTCAACAACAAAGAAAGTGAAGAATTCTGGGGACCATGGTGGAAAAGAGACGTCAGAATCCATGGTTAAAGATGCAAAGAAGAACGATTTGATCATAAGATCTACCGGTAGTATTAACGTCCATAATTTAGCTTCTGTTTGCTCAAAAAGAGGCGAAAAGGGTGTGAATCAAGATTGTTGCATCGTATGGGAGGAATATGGAGGCCAGGAGGATAT...

CDS

Download CDS FASTA

1086 bp · LXL04_016709|LXL04_016709|OH1004|CDS

ATGGGGCGTTTCACATCCATGTTTAATGGGCTAACAAAGTCTTTTTCAACAACAAAGAAAGTGAAGAATTCTGGGGACCATGGTGGAAAAGAGACGTCAGAATCCATGGTTAAAGATGCAAAGAAGAACGATTTGATCATAAGATCTACCGGTAGTATTAACGTCCATAATTTAGCTTCTGTTTGCTCAAAAAGAGGCGAAAAGGGTGTGAATCAAGATTGTTGCATCGTATGGGAGGAATATGGAGGCCAGGAGGATAT...

Protein

Download Protein FASTA

361 aa · LXL04_016709|LXL04_016709|OH1004|PROTEIN

MGRFTSMFNGLTKSFSTTKKVKNSGDHGGKETSESMVKDAKKNDLIIRSTGSINVHNLASVCSKRGEKGVNQDCCIVWEEYGGQEDMTFCGVFDGHGSWGHYVAKKVCESIPSSLLRDWQQEMLLEASLDDLESLKKLDRFHLWKNSFLKTCASVDQDLQECRKFDSFHSGTTALAVVKQGELLVIANVGDSRAVLATTGDDGCLVPVQVTIDFKPNLTHEEERIVECNGRVFCLEDEPGVHRLWRPDGETPGLAMSRAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016709`
TK1151 ID	TkA02G109420
OH-1004 ID	LXL04_016709
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 99.718 / OH-1004 98.061 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016709

Location Chr03:131958788-131960206 (+)

Description Similar to PPC6-7: Probable protein phosphatase 2C 73

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g27930`	Probable protein phosphatase 2C 73.	No verified direct reference in this release
`At3g05640`	Probable protein phosphatase 2C 34.	No verified direct reference in this release
`At3g16800`	Probable protein phosphatase 2C 41.	No verified direct reference in this release
`At1g79630`	Probable protein phosphatase 2C 18.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0358500`	Probable protein phosphatase 2C 48.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016709 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0006470 protein dephosphorylation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009819 drought recovery Biological Process

GO:0045926 negative regulation of growth Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT1G79630

ath:AT3G05640

ath:AT3G16800

ath:AT5G27930

dosa:Os05g0358500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.506

Rank 1 · LXL04_016709 · OH-1004

Cytoplasm0.413

Rank 2 · LXL04_016709 · OH-1004

Cell membrane0.135

Rank 3 · LXL04_016709 · OH-1004

Endoplasmic reticulum0.065

Rank 4 · LXL04_016709 · OH-1004

Mitochondrion0.059

Rank 5 · LXL04_016709 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13672.12PP2C_268-306 aa

PF00481.27PP2C82-322 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016709	`PF13672.12`	PP2C_2	68	306	6.6e-07	29.9
LXL04_016709	`PF00481.27`	PP2C	82	322	6.9e-41	141.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WRB2`	Arabidopsis thaliana	Probable protein phosphatase 2C 73	63.456%	Swiss-Prot	strong database homology
`Q9M9W9`	Arabidopsis thaliana	Probable protein phosphatase 2C 34	64.306%	Swiss-Prot	strong database homology
`Q9LRZ4`	Arabidopsis thaliana	Probable protein phosphatase 2C 41	53.672%	Swiss-Prot	strong database homology
`Q8RXZ4`	Arabidopsis thaliana	Probable protein phosphatase 2C 18	43.363%	Swiss-Prot	moderate database homology
`Q6L482`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 48	55.462%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card