TkA02G102410 | RubberDandelionOmics

Gene overview

TkA02G102410

Reference: TK1151 Chr: Chr02 Coordinates: 26767676-26768305 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

539 bp · TkA02G102410|TK1151|cDNA

TTACTTCCTTTTCACCAATTTGAACCAATTTTTACTTTTCACGAACTAATAAGCCGAGTATCTCACTGAAATGGATTACGGTGTGCAGAAATTTTCACGCCATGGCTCAGGAACGCGACGAACTCACTGAAGCTCTCAACGATCTATTCACCAATGTTTCCACCATGATTAAAGGCGATCTTCAGGGTACAAACAATGTTCTCAAATTGTTGGAAAACATGAATCTGAAAGTTGCAGAAGAGTACCAAGGATTTGGTGAC...

CDS

Download CDS FASTA

357 bp · TkA02G102410|TK1151|CDS

ATGGCTCAGGAACGCGACGAACTCACTGAAGCTCTCAACGATCTATTCACCAATGTTTCCACCATGATTAAAGGCGATCTTCAGGGTACAAACAATGTTCTCAAATTGTTGGAAAACATGAATCTGAAAGTTGCAGAAGAGTACCAAGGATTTGGTGACGTTGCTTCTGGTTTGAGGGTTTTTGTGGAACGATTAAAGGCCAAAACTGAGAATTTTGATGAGTATGCTCAACAAATTGATGTTATAGAAAAGCAAGTAAC...

Protein

Download Protein FASTA

118 aa · TkA02G102410|TK1151|PROTEIN

MAQERDELTEALNDLFTNVSTMIKGDLQGTNNVLKLLENMNLKVAEEYQGFGDVASGLRVFVERLKAKTENFDEYAQQIDVIEKQVTDLEVVISMLDKYVCLLESKVQSVYQMPALLS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G102410`
TK1151 ID	TkA02G102410
OH-1004 ID	LXL04_037980
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.800
Protein coverage (%)	TK1151 95.763 / OH-1004 61.749 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G102410

Location Chr02:26767676-26768305 (+)

Description Similar to BLOS2: Biogenesis of lysosome-related organelles complex 1 subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49550`	Component of the biogenesis of lysosome-related organelles complex-1 (BLOC-1), a complex that mediates the vacuolar degradative transport via the intracellular vesicle trafficking from the endosome to the vacuole.	BLOS1, a putative BLOC-1 subunit, interacts with SNX1 and modulates root growth in Arabidopsis.2010 · DOI: 10.1242/jcs.069732

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037980 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007020 microtubule nucleation Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0016197 endosomal transport Biological Process

GO:0032418 lysosome localization Biological Process

GO:0032438 melanosome organization Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0051036 regulation of endosome size Biological Process

GO:0060155 platelet dense granule organization Biological Process

GO:0062196 regulation of lysosome size Biological Process

GO:0072384 organelle transport along microtubule Biological Process

GO:0000930 gamma-tubulin complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G49550

ddi:DDB_G0278387

hsa:282991

mcf:102120191

xtr:493563

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.707

Rank 1 · TkA02G102410 · TK1151

Nucleus0.341

Rank 2 · TkA02G102410 · TK1151

Golgi apparatus0.058

Rank 3 · TkA02G102410 · TK1151

Lysosome / Vacuole0.050

Rank 4 · TkA02G102410 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA02G102410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24161CCDC392-110 aa

PF23991DUF73103-20 aa

PF24611Spectrin_Anc-13-41 aa

PF07889DUF16643-53 aa

PF05531NPV_P106-39 aa

PF04513Baculo_PEP_C7-91 aa

PF10046BLOC1_214-107 aa

PF05791Bacillus_HBL20-82 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G102410	`PF24161`	CCDC39	2	110	0.17	10.4
TkA02G102410	`PF23991`	DUF7310	3	20	0.0097	17.1
TkA02G102410	`PF24611`	Spectrin_Anc-1	3	41	0.13	13.2
TkA02G102410	`PF07889`	DUF1664	3	53	0.27	12.0
TkA02G102410	`PF05531`	NPV_P10	6	39	0.17	13.1
TkA02G102410	`PF04513`	Baculo_PEP_C	7	91	0.084	13.6
TkA02G102410	`PF10046`	BLOC1_2	14	107	3.9e-28	98.4
TkA02G102410	`PF05791`	Bacillus_HBL	20	82	0.064	13.8
TkA02G102410	`PF07889`	DUF1664	58	110	0.27	12.0
TkA02G102410	`PF10158`	LOH1CR12	59	105	0.022	15.6
TkA02G102410	`PF24611`	Spectrin_Anc-1	62	90	0.13	13.2
TkA02G102410	`PF05531`	NPV_P10	62	94	0.17	13.1
TkA02G102410	`PF23991`	DUF7310	64	110	0.0097	17.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K657`	Arabidopsis thaliana	sp\|F4K657\|BL1S2_ARATH Biogenesis of lysosome-related organelles complex 1 subunit 2	60.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card