TkA02G016810 | RubberDandelionOmics

Gene overview

TkA02G016810

Reference: TK1151 Chr: Chr02 Coordinates: 3926325-3927862 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1398 bp · TkA02G016810|TK1151|cDNA

TTACATATATACCAACATAAGATATCATCTCAGTTTTTATACTTACATACAAAATTCTTTTCATAACCGGTTCTTTTATTCATTCTCAATCTTCATGAGAAGATCTTAAACCAAAACGATTACATGGCAGACTGGAGTTGAAAGAAGATAGGTAGATGGAGTTGGGAGATGGAGAGGAGAGATGGAATCAGAAGAAGGTAACACCAATCGATGAAATTTCCCACAGATTGATCGACGGAGAGCTTTACACGAAGATTCAG...

CDS

Download CDS FASTA

1053 bp · TkA02G016810|TK1151|CDS

ATGGAGTTGGGAGATGGAGAGGAGAGATGGAATCAGAAGAAGGTAACACCAATCGATGAAATTTCCCACAGATTGATCGACGGAGAGCTTTACACGAAGATTCAGGCGGCCATGGATATCCGGAGCATGATCCGAAATCGTAACTCCCCCGAAAAAATTCGCGCCAAGTTCGCCACGGCAGGTGTCATTCCACCCCTTGTTCTTATGCTCTGCTCGCAACATCATGATGCTCGTGAAGCTTCACTTCTCGCCCTCCTCAA...

Protein

Download Protein FASTA

350 aa · TkA02G016810|TK1151|PROTEIN

MELGDGEERWNQKKVTPIDEISHRLIDGELYTKIQAAMDIRSMIRNRNSPEKIRAKFATAGVIPPLVLMLCSQHHDAREASLLALLNLASRNERNKEHIVKCGAISPLVKLLKFQNTSRIRELATAAILTLSATQRNKPAIAASAAIPLLIQILSSRSDQERVDAVTTLHNLSTSNQEPAIVLEANAAPPLLDLLKECKKYSKCADKTTALIEIISKSPEGRLAITNSEDGILTLVETVEDGSLVSKEHAVGALLTLCLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G016810`
TK1151 ID	TkA02G016810
OH-1004 ID	LXL04_017669
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G016810

Location Chr02:3926325-3927862 (-)

Description Similar to PUB3: U-box domain-containing protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27910`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017669 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0034614 cellular response to reactive oxygen species Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048364 root development Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:1904821 chloroplast disassembly Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G24330

ath:AT2G23140

ath:AT3G46510

ath:AT3G54790

ath:AT5G67340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.500

Rank 1 · TkA02G016810 · TK1151

Nucleus0.373

Rank 2 · TkA02G016810 · TK1151

Cell membrane0.206

Rank 3 · TkA02G016810 · TK1151

Endoplasmic reticulum0.048

Rank 4 · TkA02G016810 · TK1151

Lysosome / Vacuole0.034

Rank 5 · TkA02G016810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25598ARM_PUB22-142 aa

PF23654ARM_LIN_2nd35-162 aa

PF22964ZER1-like_2nd50-167 aa

PF24768ARM_ARMC551-134 aa

PF05804KAP57-201 aa

PF11701UNC45-central57-132 aa

PF13513HEAT_EZ58-85 aa

PF00514Arm60-90 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G016810	`PF25598`	ARM_PUB	22	142	1.9e-21	77.5
TkA02G016810	`PF23654`	ARM_LIN_2nd	35	162	0.00031	21.1
TkA02G016810	`PF22964`	ZER1-like_2nd	50	167	3.5e-06	26.6
TkA02G016810	`PF24768`	ARM_ARMC5	51	134	3.4e-16	60.2
TkA02G016810	`PF05804`	KAP	57	201	3.3e-05	23.0
TkA02G016810	`PF11701`	UNC45-central	57	132	0.044	14.3
TkA02G016810	`PF13513`	HEAT_EZ	58	85	0.026	15.8
TkA02G016810	`PF00514`	Arm	60	90	4.6e-22	78.0
TkA02G016810	`PF02985`	HEAT	62	90	0.34	12.0
TkA02G016810	`PF04826`	Arm_2	66	99	0.00054	20.3
TkA02G016810	`PF23628`	ARM_LIN_C	69	133	6.6e-05	22.8
TkA02G016810	`PF25151`	TPR_Trm732_C	80	136	0.073	13.7
TkA02G016810	`PF30700`	ARM_GAC_1st	81	153	0.023	12.7
TkA02G016810	`PF25786`	HEAT_GCN1_C	84	205	0.016	15.9
TkA02G016810	`PF29313`	BAR1_C	84	116	0.052	13.4
TkA02G016810	`PF30196`	WRM1_C	90	212	0.0099	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7G1`	Arabidopsis thaliana	sp\|Q9C7G1\|PUB45_ARATH U-box domain-containing protein 45	30.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card