TkA01G630360 | RubberDandelionOmics

Gene overview

TkA01G630360

Reference: TK1151 Chr: Chr01 Coordinates: 159401801-159404475 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1421 bp · TkA01G630360|TK1151|cDNA

AAACTATGGGCGACGATTGCACCAAGTGTGGGGTACGGCTGACAAACAACATACATATTTTATTAGATACAACGGCTCCCCCCAAAACCCCCCATCTTTGACCCCTTTGGATTCATCATCCACGCTATTTCTCCCCACTTCATCCCCACACCATCTGGTAGTGGATCACTCATCGGTGGAGAAATTTGAGCATTTAATACCCCAAACAGGTCCCAATGGAGTTCTTGCAAGCGCCTAATGTCCAAGTTGGGATTGCCTTC...

CDS

Download CDS FASTA

831 bp · TkA01G630360|TK1151|CDS

ATGGAGTTCTTGCAAGCGCCTAATGTCCAAGTTGGGATTGCCTTCGCTGTTGTGATTGTTACCCTTGTTGCTTTCATCGTTTTCTCCTCCAAGAAAACCAAAGGTTCCATAGATCCTGAAAACTATAAACAATTCAAGCTTGTCAAACGCACGCAACTTAGCCATAATGTGGCCAAATTCAGATTTGCTCTTCCTACACCTACTTCAGTATTGGGACTTCCCATTGGACAACATATCAGTTGCAGGGGTAAAGATAGCCA...

Protein

Download Protein FASTA

276 aa · TkA01G630360|TK1151|PROTEIN

MEFLQAPNVQVGIAFAVVIVTLVAFIVFSSKKTKGSIDPENYKQFKLVKRTQLSHNVAKFRFALPTPTSVLGLPIGQHISCRGKDSQGEEVIKPYTPTTLDSDVGYFELVIKMYPQGRMSHHFREMREGDYMAVKGPKGRFRYQPGQVRAFGMIAGGSGITPMFQVARAVLENPADKTKVHLIYANVTSDDILLKAKLEGLSSNYPDRFKVYYVLNQPPEGWTGGVGFVTKEMIEAHLPARASDIKILRCGPPPMNKAMA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G630360`
TK1151 ID	TkA01G630360
OH-1004 ID	LXL04_000164
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	92.800
Protein coverage (%)	TK1151 100.000 / OH-1004 26.939 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G630360

Location Chr01:159401801-159404475 (+)

Description Similar to SCL9: Scarecrow-like protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17770`	Reductase transferring electrons from NADH to cytochrome b5.	A mutation in Arabidopsis cytochrome b5 reductase identified by high-throughput screening differentially affects hydroxylation and desaturation.2006 · DOI: 10.1111/j.1365-313x.2006.02925.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000164 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0022900 electron transport chain Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0080183 response to photooxidative stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G07530

ath:AT2G29060

ath:AT2G29065

ath:AT2G37650

ath:AT5G17770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.386

Rank 1 · TkA01G630360 · TK1151

Mitochondrion0.347

Rank 2 · TkA01G630360 · TK1151

Cytoplasm0.210

Rank 3 · TkA01G630360 · TK1151

Cell membrane0.095

Rank 4 · TkA01G630360 · TK1151

Nucleus0.082

Rank 5 · TkA01G630360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00970FAD_binding_645-143 aa

PF00175NAD_binding_1153-259 aa

PF08030NAD_binding_6153-192 aa

PF08030NAD_binding_6241-259 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G630360	`PF00970`	FAD_binding_6	45	143	1.9e-34	118.7
TkA01G630360	`PF00175`	NAD_binding_1	153	259	1.8e-31	109.7
TkA01G630360	`PF08030`	NAD_binding_6	153	192	0.00079	20.2
TkA01G630360	`PF08030`	NAD_binding_6	241	259	0.00079	20.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZNT1`	Arabidopsis thaliana	sp\|Q9ZNT1\|NB5R1_ARATH NADH--cytochrome b5 reductase 1	76.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card