TkA01G578650 | RubberDandelionOmics

Gene overview

TkA01G578650

Reference: TK1151 Chr: Chr01 Coordinates: 145509526-145512616 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1960 bp · TkA01G578650|TK1151|cDNA

AAAAAAGTATAAAGCATTAAAGCAACTGTAAGAAAAAGATTATTCAACGAAAACAGAAAGGCATTTAACTCCAAAAGAAACGGTTCCAAGACAATGAGCATGAGTACATACAGATAATGTGGATGCCAAAACTTGGCTCCTTTTGAATACACGTATATTTTGTTAGGTAATAATTACAAAAAAAATCTTCCATTTATTCATCTTCTTCCTGCGGGACTTTCACAACTTTCACAACCTTCCAGCTATTGATCCTTACCTGC...

CDS

Download CDS FASTA

1170 bp · TkA01G578650|TK1151|CDS

ATGGAGAATGGGTTGAATCTGAAGGCAATGGATGCAGAGCAACTAAGAGAACACGGCCACAAAATGGTGGATTTCATTGCCGACTACTACAAGAACATCGAGAATTTCCCTGTTCTCAGCCAAGTCGAGCCAGGATATCTCCAAAATCTTCTTCCCGATTCTGCACCACTACTTCCTGAATCATTGCAAGCAGTTCTTCAAGACGTTGAAACGAAGATATTGCCAGGTGTCACCCACTGGCAAAGTCCGAACTATTACGC...

Protein

Download Protein FASTA

389 aa · TkA01G578650|TK1151|PROTEIN

MENGLNLKAMDAEQLREHGHKMVDFIADYYKNIENFPVLSQVEPGYLQNLLPDSAPLLPESLQAVLQDVETKILPGVTHWQSPNYYAYFPANSSVAGFLGEMLSAGINMVGFSWITSPAATELEMIVLDWLANLLKLPHDFLSTGPGGGAIQGTASEALLVVLLAARDKVLREVGKDALGKLVVYGSDQTHSSLQKACQIAGIHSENCKLIKTEMCNEYALSPESVTNAISHDVSSGLIPLLLCATVGTTSSTAVDPLLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G578650`
TK1151 ID	TkA01G578650
OH-1004 ID	LXL04_027660
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	53.300
Protein coverage (%)	TK1151 65.553 / OH-1004 87.931 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G578650

Location Chr01:145509526-145512616 (-)

Description Similar to TYDC3: Tyrosine/DOPA decarboxylase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20340`	Bifunctional enzyme that catalyzes the decarboxylation of L- phenylalanine to 2-phenylethylamine, which is then oxidized to form 2- phenylacetaldehyde, a constituent of floral scent.	Role of aromatic aldehyde synthase in wounding/herbivory response and flower scent production in different Arabidopsis ecotypes.2011 · DOI: 10.1111/j.1365-313x.2011.04515.x
`At4g28680`	Converts tyrosine into tyramine, a precursor of isoquinoline alkaloids and various amides.	Gene expression and characterization of a stress-induced tyrosine decarboxylase from Arabidopsis thaliana.2009 · DOI: 10.1016/j.febslet.2009.05.017 Role of aromatic aldehyde synthase in wounding/herbivory response and flower scent production in different Arabidopsis ecotypes.2011 · DOI: 10.1111/j.1365-313x.2011.04515.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0437500`	Involved in serotonin biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027660 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006520 amino acid metabolic process Biological Process

GO:0009821 alkaloid biosynthetic process Biological Process

GO:0019752 carboxylic acid metabolic process Biological Process

GO:0042444 phenylethylamine biosynthetic process Biological Process

GO:1901695 tyramine biosynthetic process Biological Process

GO:1903184 L-dopa metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0004837 tyrosine decarboxylase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0036467 5-hydroxy-L-tryptophan decarboxylase activity Molecular Function

GO:0036468 L-dopa decarboxylase activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.676

Rank 1 · TkA01G578650 · TK1151

Nucleus0.216

Rank 2 · TkA01G578650 · TK1151

Peroxisome0.120

Rank 3 · TkA01G578650 · TK1151

Mitochondrion0.112

Rank 4 · TkA01G578650 · TK1151

Endoplasmic reticulum0.058

Rank 5 · TkA01G578650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00282Pyridoxal_deC44-366 aa

PF01212Beta_elim_lyase152-313 aa

PF05889SepSecS174-279 aa

PF00155Aminotran_1_2182-281 aa

PF00266Aminotran_5183-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G578650	`PF00282`	Pyridoxal_deC	44	366	4.5e-103	345.6
TkA01G578650	`PF01212`	Beta_elim_lyase	152	313	0.081	13.0
TkA01G578650	`PF05889`	SepSecS	174	279	0.0067	15.9
TkA01G578650	`PF00155`	Aminotran_1_2	182	281	0.14	12.1
TkA01G578650	`PF00266`	Aminotran_5	183	277	0.18	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RY79`	Arabidopsis thaliana	sp\|Q8RY79\|PAAS_ARATH Phenylacetaldehyde synthase	74.900%	Swiss-Prot	High
`Q9M0G4`	Arabidopsis thaliana	sp\|Q9M0G4\|TYDC2_ARATH Tyrosine decarboxylase 2	66.600%	Swiss-Prot	High
`Q7XHL3`	Oryza sativa subsp. japonica	sp\|Q7XHL3\|TDC2_ORYSJ Tryptophan decarboxylase 2	73.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card