TkA01G550120 | RubberDandelionOmics

Gene overview

TkA01G550120

Reference: TK1151 Chr: Chr01 Coordinates: 138263229-138266684 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2923 bp · TkA01G550120|TK1151|cDNA

CAATAAAATAAAAAACCCAAATCTTTTTCTTCAATTTGATTCAAATAAACCCTCAATATATCGAATAAACTCAAACCCCACAAAGATTCAAAGATCAGTAGTATAATCGAAAGAAAGAAGAAAGAGAAATGGGAAAATTAGCCGTTAGAGACGAAGACGACCTCGCTGAAATCTCAGCAACTTGGCAAAGGCGAAGACGAGCGATGGCGAAGGCGAGCACAGGCGGTGCTGTTTGGCGAGCTTCGGCGAGAGGGATGGCG...

CDS

Download CDS FASTA

1932 bp · TkA01G550120|TK1151|CDS

ATGGATTCGTGTTTAATTCTCTCTCTCCTCACAGAGGACCTCCTAGCACGAGTTCTTGATTATCTCTTCGATGATTCCGACCGCAAATCGTTCCGTGCAACCTGCAAGTTTTTCCACCGTGTTGAATCTGGTCACCGGACTTGTCTGAAGTTCTTACGACCGGAGTTCATTCCAGGTCTCCTCAGAACTTACACCCGCGCGGACACGCTTGACTTCTCCGTCTGTCCACGGATCTACGATTGGACACTCTCTGTTTTGCT...

Protein

Download Protein FASTA

643 aa · TkA01G550120|TK1151|PROTEIN

MDSCLILSLLTEDLLARVLDYLFDDSDRKSFRATCKFFHRVESGHRTCLKFLRPEFIPGLLRTYTRADTLDFSVCPRIYDWTLSVLLNNVSCHGWARRLKRVVLCRTTSLRFSGIEMLVRSCPGLQVVDVSHCSQFGDREAAALSCATELREVKMDKCLRVTDVGLAKIAIGCEKLEKISLKWCLEITDLGIDLLSKKCPQLKHLCVSYLKISNESLRSLSCLKKLQALVMVGCNFLGDGGLHFLGNGCPSLQTLDVSRC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G550120`
TK1151 ID	TkA01G550120
OH-1004 ID	LXL04_001280
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G550120`
Location	Chr01:138263229-138266684 (+)
Description	Similar to FBL3: F-box/LRR-repeat protein 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001280` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006289 nucleotide-excision repair Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0010225 response to UV-C Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0019005 SCF ubiquitin ligase complex Cellular Component
KEGG gene cross-reference	ath:AT4G15475 ath:AT5G01720 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.621

Rank 1 · TkA01G550120 · TK1151

Cytoplasm0.186

Rank 2 · TkA01G550120 · TK1151

Mitochondrion0.089

Rank 3 · TkA01G550120 · TK1151

Cell membrane0.047

Rank 4 · TkA01G550120 · TK1151

Plastid0.044

Rank 5 · TkA01G550120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18511F-box_511-45 aa

PF25372LRR_FBXL1586-195 aa

PF29594LRR_SKP2108-132 aa

PF29594LRR_SKP2109-186 aa

PF23952LRR_EndoS109-132 aa

PF12799LRR_4114-135 aa

PF24758LRR_At5g56370119-184 aa

PF23598LRR_14119-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G550120	`PF18511`	F-box_5	11	45	0.013	15.7
TkA01G550120	`PF25372`	LRR_FBXL15	86	195	4.1e-33	115.3
TkA01G550120	`PF29594`	LRR_SKP2	108	132	7e-24	85.2
TkA01G550120	`PF29594`	LRR_SKP2	109	186	7e-24	85.2
TkA01G550120	`PF23952`	LRR_EndoS	109	132	0.0045	17.9
TkA01G550120	`PF12799`	LRR_4	114	135	7.3e-16	58.6
TkA01G550120	`PF24758`	LRR_At5g56370	119	184	3.6e-13	50.4
TkA01G550120	`PF23598`	LRR_14	119	231	3.6e-07	30.0
TkA01G550120	`PF23247`	LRR_RPS2	121	135	0.0065	17.2
TkA01G550120	`PF13516`	LRR_6	125	139	1.5e-21	75.4
TkA01G550120	`PF00560`	LRR_1	125	134	0.0028	18.1
TkA01G550120	`PF23622`	LRR_At1g61320_AtMIF1	127	208	5.3e-07	30.1
TkA01G550120	`PF18511`	F-box_5	138	146	0.013	15.7
TkA01G550120	`PF23247`	LRR_RPS2	145	184	0.0065	17.2
TkA01G550120	`PF23952`	LRR_EndoS	149	189	0.0045	17.9
TkA01G550120	`PF12799`	LRR_4	151	181	7.3e-16	58.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card