TkA01G546070 | RubberDandelionOmics

Gene overview

TkA01G546070

Reference: TK1151 Chr: Chr01 Coordinates: 137105840-137108459 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2230 bp · TkA01G546070|TK1151|cDNA

GTCCTTCTTCCTTCCTCCATCGATCTCCATAGCCAAGCATTTCAAGCTCCTTAACCTAATCAACCCAAACCTCACCTCTGCATTCTTCCACTACCAAAACCCCCAAATTTATTACTTACATGCTAACCTCCTGATTCTGCTTTTCGATCTAACGTTGCGGTGATGGCTCTCGCCTGATTTTAGGGGTTTTCATAGTTCTTCTTCCCTTCACTCCGCGGTAACTACTGTTTCTGTATTATTTTATTTCTAGTAGTTTGCAA...

CDS

Download CDS FASTA

1647 bp · TkA01G546070|TK1151|CDS

ATGGAAGGGAAGCTGATCAATTCAGCAGGAATTTTGCTTTTTTCTGCTTGCTTCCTGCTTCAATTTGCAAGTCTGAACGCGGTTTCAAATGATTCCTTTCTCATCACATCTTCTCGTAATGAAAGCCACATAGAAGTATGCCCTCCTGGTTGGGTGAAGGGACCAAGCAAATCAAAATGTTATAAACACATTGAAAGCTCTTCATCATGGAACGAGTCAGAAAACATCTGCAGAAGTTACCATGGCCACCTGGCAGCATT...

Protein

Download Protein FASTA

548 aa · TkA01G546070|TK1151|PROTEIN

MEGKLINSAGILLFSACFLLQFASLNAVSNDSFLITSSRNESHIEVCPPGWVKGPSKSKCYKHIESSSSWNESENICRSYHGHLAAFTSLPELTFSQNLCNDCWVGGRSIGNGNPWMWSDKTYTWNQTLLTVLTPDLKSTCTNSSCIYPANSASMCTTLTNRTTSLIANKCNISRSSLCMLVTDNRCQHMHCHKEYLIILAIVSGLILFTTFAVVIWLLVYKRSKRRRKSRKLSNPAELALVPPSWKVFTREELRSITKN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G546070`
TK1151 ID	TkA01G546070
OH-1004 ID	LXL04_001338
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 82.406 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G546070

Location Chr01:137105840-137108459 (-)

Description Similar to At1g52310: C-type lectin receptor-like tyrosine-protein kinase At1g52310

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g52310`	C-type lectin receptor-like tyrosine-protein kinase At1g52310.	No verified direct reference in this release
`At2g30730`	Receptor-like cytoplasmic kinase (RLCK) that triggers abscisic acid (ABA) signaling in response to dehydration by phosphorylating and activating ABA receptors to support their monomerization and enhance their ABA binding affinity; they in turn repress PP2C protein phosphatases acting as negative regulators of ABA responses (By similarity).	Catalytically inactive subgroup VIII receptor-like cytoplasmic kinases regulate the immune-triggered oxidative burst in Arabidopsis thaliana.2025 · DOI: 10.1093/jxb/erae486
`At5g02800`	Serine/threonine-protein kinase involved in the positive regulation of brassinosteroid (BR) signaling and plant growth.	No verified direct reference in this release
`At3g15890`	PTI1-like tyrosine-protein kinase At3g15890.	No verified direct reference in this release
`At3g02810`	Involved in pollen tube guidance into micropyle.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001338 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:1900459 positive regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090404 pollen tube tip Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G52310

ath:AT3G02810

ath:AT3G15890

ath:AT5G02800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.865

Rank 1 · TkA01G546070 · TK1151

Cytoplasm0.084

Rank 2 · TkA01G546070 · TK1151

Endoplasmic reticulum0.076

Rank 3 · TkA01G546070 · TK1151

Nucleus0.052

Rank 4 · TkA01G546070 · TK1151

Lysosome / Vacuole0.024

Rank 5 · TkA01G546070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00059Lectin_C67-180 aa

PF00558Vpu199-235 aa

PF06667PspB202-235 aa

PF00069Pkinase265-541 aa

PF07714PK_Tyr_Ser-Thr266-543 aa

PF01636APH292-345 aa

PF01636APH364-399 aa

PF00504Chloroa_b-bind409-444 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G546070	`PF00059`	Lectin_C	67	180	1.7e-07	32.7
TkA01G546070	`PF00558`	Vpu	199	235	0.0052	17.3
TkA01G546070	`PF06667`	PspB	202	235	0.053	14.3
TkA01G546070	`PF00069`	Pkinase	265	541	2e-34	119.9
TkA01G546070	`PF07714`	PK_Tyr_Ser-Thr	266	543	1.8e-38	133.1
TkA01G546070	`PF01636`	APH	292	345	0.051	14.0
TkA01G546070	`PF01636`	APH	364	399	0.051	14.0
TkA01G546070	`PF00504`	Chloroa_b-bind	409	444	0.22	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C823`	Arabidopsis thaliana	sp\|Q9C823\|Y1523_ARATH C-type lectin receptor-like tyrosine-protein kinase At1g52310	62.100%	Swiss-Prot	High
`O49338`	Arabidopsis thaliana	sp\|O49338\|CARK9_ARATH Protein CYTOSOLIC ABA RECEPTOR KINASE 9	37.300%	Swiss-Prot	Medium
`Q0WRY5`	Arabidopsis thaliana	sp\|Q0WRY5\|PBL7_ARATH Probable serine/threonine-protein kinase PBL7	39.700%	Swiss-Prot	Medium
`Q9LSC2`	Arabidopsis thaliana	sp\|Q9LSC2\|Y3589_ARATH PTI1-like tyrosine-protein kinase At3g15890	38.700%	Swiss-Prot	Medium
`Q9M8S2`	Arabidopsis thaliana	sp\|Q9M8S2\|LIPG2_ARATH Receptor-like kinase LIP2	40.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card