LXL04_001338 | RubberDandelionOmics

Gene overview

LXL04_001338

Reference: OH-1004 Chr: Chr01 Coordinates: 24396824-24402203 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1998 bp · LXL04_001338|LXL04_001338|OH1004|cDNA

ATGTATTGCTCGTCGGCGAGGGGGAGAGAAAGAGGAGGGCATCGACTATTCCTGCGTTTTCCGGCGTGTGCTGCTCCTCCTTCTCTGTTCTCCGGCGATCGTGAACCTTCCCAGCAGCCGATTGCAACGACAACAGATCTCATCCTGGGGATGCAAACAGATACTTGGAGATTTCTTCAAGAAGTAGTAGAACAGAAGAAAAAACTCGATGATGAATCAGAAAAGAAAAAACAACTCGAGCAAGCTCAAATAAGTAACTT...

CDS

Download CDS FASTA

1998 bp · LXL04_001338|LXL04_001338|OH1004|CDS

ATGTATTGCTCGTCGGCGAGGGGGAGAGAAAGAGGAGGGCATCGACTATTCCTGCGTTTTCCGGCGTGTGCTGCTCCTCCTTCTCTGTTCTCCGGCGATCGTGAACCTTCCCAGCAGCCGATTGCAACGACAACAGATCTCATCCTGGGGATGCAAACAGATACTTGGAGATTTCTTCAAGAAGTAGTAGAACAGAAGAAAAAACTCGATGATGAATCAGAAAAGAAAAAACAACTCGAGCAAGCTCAAATAAGTAACTT...

Protein

Download Protein FASTA

665 aa · LXL04_001338|LXL04_001338|OH1004|PROTEIN

MYCSSARGRERGGHRLFLRFPACAAPPSLFSGDREPSQQPIATTTDLILGMQTDTWRFLQEVVEQKKKLDDESEKKKQLEQAQISNLCYSGAYWEFGIIIFDSLMGFHSSSSLHSAVMEGKLINSAGILLFSACFLLQFASLNAVSNDSFLITSSRNESHIEVCPPGWVKGPSKSKCYKHIESSSSWNESENICRSYHGHLAAFTSLPELTFSQNLCNDCWVGGRSIGNGNPWMWSDKTYTWNQTLVTVLTPDLKSTCTN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001338`
TK1151 ID	TkA01G546070
OH-1004 ID	LXL04_001338
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 82.406 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001338

Location Chr01:24396824-24402203 (+)

Description Similar to At1g52310: C-type lectin receptor-like tyrosine-protein kinase At1g52310

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g52310`	C-type lectin receptor-like tyrosine-protein kinase At1g52310.	No verified direct reference in this release
`At5g02800`	Serine/threonine-protein kinase involved in the positive regulation of brassinosteroid (BR) signaling and plant growth.	No verified direct reference in this release
`At2g30730`	Receptor-like cytoplasmic kinase (RLCK) that triggers abscisic acid (ABA) signaling in response to dehydration by phosphorylating and activating ABA receptors to support their monomerization and enhance their ABA binding affinity; they in turn repress PP2C protein phosphatases acting as negative regulators of ABA responses (By similarity).	Catalytically inactive subgroup VIII receptor-like cytoplasmic kinases regulate the immune-triggered oxidative burst in Arabidopsis thaliana.2025 · DOI: 10.1093/jxb/erae486
`At3g02810`	Involved in pollen tube guidance into micropyle.	No verified direct reference in this release
`At3g15890`	PTI1-like tyrosine-protein kinase At3g15890.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001338 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:1900459 positive regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090404 pollen tube tip Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G52310

ath:AT3G02810

ath:AT3G15890

ath:AT5G02800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.834

Rank 1 · LXL04_001338 · OH-1004

Cytoplasm0.092

Rank 2 · LXL04_001338 · OH-1004

Endoplasmic reticulum0.091

Rank 3 · LXL04_001338 · OH-1004

Nucleus0.070

Rank 4 · LXL04_001338 · OH-1004

Lysosome / Vacuole0.028

Rank 5 · LXL04_001338 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00059.28Lectin_C184-297 aa

PF00069.32Pkinase382-658 aa

PF07714.24PK_Tyr_Ser-Thr383-660 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001338	`PF00059.28`	Lectin_C	184	297	2.3e-07	32.2
LXL04_001338	`PF00069.32`	Pkinase	382	658	2.2e-34	119.8
LXL04_001338	`PF07714.24`	PK_Tyr_Ser-Thr	383	660	2.7e-38	132.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C823`	Arabidopsis thaliana	C-type lectin receptor-like tyrosine-protein kinase At1g52310	65.649%	Swiss-Prot	strong database homology
`Q0WRY5`	Arabidopsis thaliana	Probable serine/threonine-protein kinase PBL7	39.474%	Swiss-Prot	weak database homology
`O49338`	Arabidopsis thaliana	Protein CYTOSOLIC ABA RECEPTOR KINASE 9	37.202%	Swiss-Prot	weak database homology
`Q9M8S2`	Arabidopsis thaliana	Receptor-like kinase LIP2	40.594%	Swiss-Prot	weak database homology
`Q9LSC2`	Arabidopsis thaliana	PTI1-like tyrosine-protein kinase At3g15890	38.667%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card