TkA01G528870 | RubberDandelionOmics

Gene overview

TkA01G528870

Reference: TK1151 Chr: Chr01 Coordinates: 132752208-132758599 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1009 bp · TkA01G528870|TK1151|cDNA

AAAGCCATCACCTTTTTCCATCTTTTACTTTTGTTACACTCTGATTCATCACTTCCAAAACACAATCTTCATAGACGCAAATTCAAATGATCTCCGTGCAATTTCTCGTAACATTTCTTGTACAAATCTAGTTGATGACGAGTGCTTCGAAGCTATTTCACAACAGAAGGATTCGATTTGGCGTCCACCACAACTCCGTCGACGATAGAGAATCAGATTCCTCACCAGCTGAAGGAAATTCTTCCCGCCACATCACCACC...

CDS

Download CDS FASTA

726 bp · TkA01G528870|TK1151|CDS

ATGACGAGTGCTTCGAAGCTATTTCACAACAGAAGGATTCGATTTGGCGTCCACCACAACTCCGTCGACGATAGAGAATCAGATTCCTCACCAGCTGAAGGAAATTCTTCCCGCCACATCACCACCAACCGTCGGCATCATCACCATACTAATCGCCGGAATCTCGAAGGCTGTAACGCTCCCCCTCGGCGTATCCACCGTCATCGCCTCTCGGAGCTAGTTCAGCTGGAACCAAGCAGTAGTCAATCTTCATCCGGAAG...

Protein

Download Protein FASTA

241 aa · TkA01G528870|TK1151|PROTEIN

MTSASKLFHNRRIRFGVHHNSVDDRESDSSPAEGNSSRHITTNRRHHHHTNRRNLEGCNAPPRRIHRHRLSELVQLEPSSSQSSSGSIINSEDFRNIRRWGSTENDRLPGVVLLARERLLERLRGVHISENRQNSISSSSFHEDDLLYNSYSSFIDKKLSPGLSQDALNSLMIKVYKNGEESNGSPNASRECSICLEGFEDGDEVVDLHCMHIFHSCCLFPWVEVCGACPNCRKVVVIGYK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G528870`
TK1151 ID	TkA01G528870
OH-1004 ID	LXL04_001515
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.900
Protein coverage (%)	TK1151 81.328 / OH-1004 62.903 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G528870

Location Chr01:132752208-132758599 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49850`	Probable E3 ubiquitin-protein ligase that may possess E3 ubiquitin ligase activity in vitro.	No verified direct reference in this release
`At3g19950`	E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001515 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.524

Rank 1 · TkA01G528870 · TK1151

Nucleus0.446

Rank 2 · TkA01G528870 · TK1151

Cell membrane0.122

Rank 3 · TkA01G528870 · TK1151

Lysosome / Vacuole0.062

Rank 4 · TkA01G528870 · TK1151

Endoplasmic reticulum0.052

Rank 5 · TkA01G528870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29452FAR1_N189-225 aa

PF13639zf-RING_2191-233 aa

PF17123zf-RING_11191-219 aa

PF13923zf-C3HC4_2191-232 aa

PF14634zf-RING_5191-234 aa

PF25998U-box_ZFPL1191-223 aa

PF00097zf-C3HC4192-232 aa

PF13445zf-RING_UBOX192-222 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G528870	`PF29452`	FAR1_N	189	225	0.13	13.0
TkA01G528870	`PF13639`	zf-RING_2	191	233	2.1e-11	44.6
TkA01G528870	`PF17123`	zf-RING_11	191	219	2.3e-07	31.1
TkA01G528870	`PF13923`	zf-C3HC4_2	191	232	0.0011	19.5
TkA01G528870	`PF14634`	zf-RING_5	191	234	0.06	14.1
TkA01G528870	`PF25998`	U-box_ZFPL1	191	223	0.095	13.8
TkA01G528870	`PF00097`	zf-C3HC4	192	232	0.0033	18.0
TkA01G528870	`PF13445`	zf-RING_UBOX	192	222	0.26	12.0
TkA01G528870	`PF23555`	zf-RING_Vps41	192	219	0.32	11.4
TkA01G528870	`PF23412`	zf_RING_Vps8	192	219	0.47	11.0
TkA01G528870	`PF12678`	zf-rbx1	204	233	0.011	16.7
TkA01G528870	`PF12861`	zf-ANAPC11	205	236	0.0072	17.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q852U6`	Arabidopsis thaliana	sp\|Q852U6\|RHY1A_ARATH Probable E3 ubiquitin-protein ligase RHY1A	37.400%	Swiss-Prot	Medium
`Q8LPN7`	Arabidopsis thaliana	sp\|Q8LPN7\|RNG1L_ARATH E3 ubiquitin-protein ligase RING1-like	37.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card