TkA01G524360 | RubberDandelionOmics

Gene overview

TkA01G524360

Reference: TK1151 Chr: Chr01 Coordinates: 131641475-131648506 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3700 bp · TkA01G524360|TK1151|cDNA

CTCGTAAACTGGCATTAAAAATCAGTATACAACAAATTACGCCACTTATAAATAGCGGCATTCCACTTCATTTCTAACGGCGTACATTAGAAAAAAGACACAGACTCGCTAGAAAGGAGGGTGACAAAGGGTTTTTTTTTTAACAAAAGAACACCACCCTAGCAATGGCGGCTTCAGCTTCATCTAGCCTTCTTTCATCTCGATCGCCCCTGAAATTAACCTCTCTATCTTCCCTCAGATGGAAATTACCTGTGTCAGTG...

CDS

Download CDS FASTA

1932 bp · TkA01G524360|TK1151|CDS

ATGGCGGCTTCAGCTTCATCTAGCCTTCTTTCATCTCGATCGCCCCTGAAATTAACCTCTCTATCTTCCCTCAGATGGAAATTACCTGTGTCAGTGGCGCTCCCTCGCCACCAACGACGCCGCGCCTCTCCGGTGTTCGTCGTTGTATCCATGGACGCCAAACCTACCGTCCTTGTCGCTGAAAAGCTAGGAGAAGCTGGACTTGATCTATTGAAAAGCTTTGCTAATGTTGATTGCTCGTATAACTTGAGTCCTGAGGA...

Protein

Download Protein FASTA

643 aa · TkA01G524360|TK1151|PROTEIN

MAASASSSLLSSRSPLKLTSLSSLRWKLPVSVALPRHQRRRASPVFVVVSMDAKPTVLVAEKLGEAGLDLLKSFANVDCSYNLSPEELCTKISLCDALIVRSGTKVSREVFESSGGRLKVVGRAGVGIDNVDLGAATEHGCLVVNAPTANTVAAAEHGIALLTAMARNVAQADASVKAGKWQRNKYVGVSLVGKTLAVMGFGKVGTEVARRAKGLGMHVIAHDPYAPADRAHAIGVDLVSFDEAISTADFLSLHMPLTPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G524360`
TK1151 ID	TkA01G524360
OH-1004 ID	LXL04_001578
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G524360

Location Chr01:131641475-131648506 (-)

Description Similar to PGDH1: D-3-phosphoglycerate dehydrogenase 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34200`	Involved in the plastidial phosphorylated pathway of serine biosynthesis (PPSB).	Functional characterization of the plastidial 3-phosphoglycerate dehydrogenase family in Arabidopsis.2013 · DOI: 10.1104/pp.113.226720 Arabidopsis phosphoglycerate dehydrogenase1 of the phosphoserine pathway is essential for development and required for ammonium assimilation and tryptophan biosynthesis.2013 · DOI: 10.1105/tpc.113.118992
`At3g19480`	Involved in the plastidial phosphorylated pathway of serine biosynthesis (PPSB).	No verified direct reference in this release
`At1g17745`	Involved in the plastidial phosphorylated pathway of serine biosynthesis (PPSB).	Functional characterization of the plastidial 3-phosphoglycerate dehydrogenase family in Arabidopsis.2013 · DOI: 10.1104/pp.113.226720 Regulation of serine biosynthesis in Arabidopsis. Crucial role of plastidic 3-phosphoglycerate dehydrogenase in non-photosynthetic tissues.1999 · DOI: 10.1074/jbc.274.1.397

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001578 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000096 sulfur amino acid metabolic process Biological Process

GO:0006564 L-serine biosynthetic process Biological Process

GO:0009555 pollen development Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0009643 photosynthetic acclimation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT1G17745

ath:AT3G19480

ath:AT4G34200

mja:MJ_1018

mth:MTH_970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.941

Rank 1 · TkA01G524360 · TK1151

Mitochondrion0.084

Rank 2 · TkA01G524360 · TK1151

Cytoplasm0.061

Rank 3 · TkA01G524360 · TK1151

Peroxisome0.038

Rank 4 · TkA01G524360 · TK1151

Nucleus0.028

Rank 5 · TkA01G524360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01842ACT40-64 aa

PF003892-Hacid_dh57-366 aa

PF03720UDPG_MGDP_dh_C149-187 aa

PF028262-Hacid_dh_C159-334 aa

PF00670AdoHcyase_NAD189-284 aa

PF07991KARI_N191-292 aa

PF04748Polysacc_deac_2195-232 aa

PF13478XdhC_C196-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G524360	`PF01842`	ACT	40	64	1.2e-10	41.7
TkA01G524360	`PF00389`	2-Hacid_dh	57	366	5.2e-34	117.5
TkA01G524360	`PF03720`	UDPG_MGDP_dh_C	149	187	0.019	16.1
TkA01G524360	`PF02826`	2-Hacid_dh_C	159	334	5.8e-64	215.4
TkA01G524360	`PF00670`	AdoHcyase_NAD	189	284	2.6e-05	25.1
TkA01G524360	`PF07991`	KARI_N	191	292	7.8e-05	23.0
TkA01G524360	`PF04748`	Polysacc_deac_2	195	232	0.12	12.1
TkA01G524360	`PF13478`	XdhC_C	196	300	0.017	16.3
TkA01G524360	`PF03720`	UDPG_MGDP_dh_C	208	254	0.019	16.1
TkA01G524360	`PF03720`	UDPG_MGDP_dh_C	351	387	0.019	16.1
TkA01G524360	`PF19304`	PGDH_inter	377	482	3.3e-16	60.2
TkA01G524360	`PF04748`	Polysacc_deac_2	447	483	0.12	12.1
TkA01G524360	`PF01842`	ACT	524	586	1.2e-10	41.7
TkA01G524360	`PF22629`	ACT_AHAS_ss	531	587	0.0053	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49485`	Arabidopsis thaliana	sp\|O49485\|SERA1_ARATH D-3-phosphoglycerate dehydrogenase 1, chloroplastic	82.300%	Swiss-Prot	High
`Q9LT69`	Arabidopsis thaliana	sp\|Q9LT69\|SERA3_ARATH D-3-phosphoglycerate dehydrogenase 3, chloroplastic	83.900%	Swiss-Prot	High
`O04130`	Arabidopsis thaliana	sp\|O04130\|SERA2_ARATH D-3-phosphoglycerate dehydrogenase 2, chloroplastic	79.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card