TkA01G521140 | RubberDandelionOmics

Gene overview

TkA01G521140

Reference: TK1151 Chr: Chr01 Coordinates: 130696513-130701103 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2196 bp · TkA01G521140|TK1151|cDNA

GGCGGTTTCCGTATCTTCTTACTCTCTCGTCTTCACCTGTTCGGCTCACCTCATTCTTTTTCCAAAAAATAAAGACTCTTCAATTAGTCACCATGAATTTTGCTGAATTGCTTTCACCAAATGCTGCAAACAATGTTAAAGCACCTAAAAGGCTTAGACCCAAACCAAAACCCCAACCCCAACCAAAATCCACACCTACCCCTCCACCACAGCCTACAAATAATGAGATTATAACAAGGACCGAAGAAGAACAAACTGTT...

CDS

Download CDS FASTA

1857 bp · TkA01G521140|TK1151|CDS

ATGAATTTTGCTGAATTGCTTTCACCAAATGCTGCAAACAATGTTAAAGCACCTAAAAGGCTTAGACCCAAACCAAAACCCCAACCCCAACCAAAATCCACACCTACCCCTCCACCACAGCCTACAAATAATGAGATTATAACAAGGACCGAAGAAGAACAAACTGTTGAAATTAACCAAATTTCTGAAAATACCAATAATGATTGGCAGTCTTCATTTGAAAAACCACATGAAGAGAATGCTGAACCTTTTATAACATT...

Protein

Download Protein FASTA

618 aa · TkA01G521140|TK1151|PROTEIN

MNFAELLSPNAANNVKAPKRLRPKPKPQPQPKSTPTPPPQPTNNEIITRTEEEQTVEINQISENTNNDWQSSFEKPHEENAEPFITLESLNDILPQSTTVAGDSPPVTVTETQTNYVSVDGNVENGKGLTEADLESFAQIDPLTGDEASIFNDNQDFQIENLSSVSNDAENSHFWEPLDMSAGPKVEKFKPKAPTRKVENIPSEMDYMDNESVPMFSPDELLGSSYNGITDSIPVPDFHVNEEQPPMSQVDSGIRSEHLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G521140`
TK1151 ID	TkA01G521140
OH-1004 ID	LXL04_001632
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G521140`
Location	Chr01:130696513-130701103 (+)
Description	Similar to bdp1: Transcription factor TFIIIB component B'' (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001632` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001112 DNA-templated transcription open complex formation Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006359 regulation of transcription by RNA polymerase III Biological Process GO:0045945 positive regulation of transcription by RNA polymerase III Biological Process GO:0070898 RNA polymerase III preinitiation complex assembly Biological Process GO:0000126 transcription factor TFIIIB complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0000995 RNA polymerase III general transcription initiation factor activity Molecular Function GO:0001156 TFIIIC-class transcription factor complex binding Molecular Function GO:0003677 DNA binding Molecular Function
KEGG gene cross-reference	hsa:55814 mmu:544971 sce:YNL039W spo:2538909 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · TkA01G521140 · TK1151

Cytoplasm0.171

Rank 2 · TkA01G521140 · TK1151

Mitochondrion0.017

Rank 3 · TkA01G521140 · TK1151

Cell membrane0.014

Rank 4 · TkA01G521140 · TK1151

Golgi apparatus0.007

Rank 5 · TkA01G521140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13921Myb_DNA-bind_652-70 aa

PF15963Myb_DNA-bind_7362-381 aa

PF16282SANT_DAMP1_like446-510 aa

PF15963Myb_DNA-bind_7464-545 aa

PF00249Myb_DNA-binding469-512 aa

PF13921Myb_DNA-bind_6472-512 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G521140	`PF13921`	Myb_DNA-bind_6	52	70	0.0023	18.8
TkA01G521140	`PF15963`	Myb_DNA-bind_7	362	381	1.4e-25	89.6
TkA01G521140	`PF16282`	SANT_DAMP1_like	446	510	0.12	13.4
TkA01G521140	`PF15963`	Myb_DNA-bind_7	464	545	1.4e-25	89.6
TkA01G521140	`PF00249`	Myb_DNA-binding	469	512	2.6e-10	41.0
TkA01G521140	`PF13921`	Myb_DNA-bind_6	472	512	0.0023	18.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card