TkA01G513140 | RubberDandelionOmics

Gene overview

TkA01G513140

Reference: TK1151 Chr: Chr01 Coordinates: 128606983-128610721 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1859 bp · TkA01G513140|TK1151|cDNA

AAAAAAGCCTGTTACTTTTCCTCATAGTCTTCCAAAACCCTACAAAAACACACATAGAAACACCTTCACTGTGTGTGTCTCCTACTCTCTATATAACAATACATACACACATACAACCATCAAGAATCCAACATAGACACAAACCCATTAATCTTTTTCCAGTTTTAAGCCTCCTGGTTTCATCATCAAAATGGGTTTTTTTTGGATGGTAATCTTGGTGGGGTTCGTGTTTGGTTTGATCCTAAACCATTACTTGCCAT...

CDS

Download CDS FASTA

1470 bp · TkA01G513140|TK1151|CDS

ATGGGTTTTTTTTGGATGGTAATCTTGGTGGGGTTCGTGTTTGGTTTGATCCTAAACCATTACTTGCCATTGCTGTTCTTAAAAAACAAGAAACTTGGTGCTCTTCCTCGAGGCTCATTTGGATACTTACCTCTTCTTGGTGAAACCCTAGCATTTCTTAAACCCCATCCTTCCACCACCATTGGCTCTTTTCTTCAAGATCATTGTTCTAGGTATGGAAAAGTGTTCAAATCACATTTATTCTTCTCACCTACCATTGT...

Protein

Download Protein FASTA

489 aa · TkA01G513140|TK1151|PROTEIN

MGFFWMVILVGFVFGLILNHYLPLLFLKNKKLGALPRGSFGYLPLLGETLAFLKPHPSTTIGSFLQDHCSRYGKVFKSHLFFSPTIVSCDQELNYFILQNEDKLFECSYPKPIHDVLGKISMLVVVGDTHKRLRNVALSLVSTTKSKPDFLTHIEKTTLQILESWKDKKQIIFCEEARKFTFNIIVKQVLGLTPEEPQTARILEDFLTFMRGLISFPLYIPGTPYANAVKARIRISASVKQIIKERRRNNNIIYNNDDNI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G513140`
TK1151 ID	TkA01G513140
OH-1004 ID	LXL04_001766
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G513140

Location Chr01:128606983-128610721 (+)

Description Similar to CYP724B1: Cytochrome P450 724B1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50660`	Catalyzes the C22-alpha-hydroxylation step in brassinosteroids biosynthesis.	Arabidopsis CYP90B1 catalyses the early C-22 hydroxylation of C27, C28 and C29 sterols.2006 · DOI: 10.1111/j.1365-313x.2005.02639.x The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22alpha-hydroxylation steps in brassinosteroid biosynthesis.1998 · DOI: 10.1105/tpc.10.2.231

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8AV52`	Involved in brassinosteroid biosynthesis (By similarity).	No verified direct reference in this release
`Os04g0469800`	Involved in brassinosteroid biosynthesis.	A novel cytochrome P450 is implicated in brassinosteroid biosynthesis via the characterization of a rice dwarf mutant, dwarf11, with reduced seed length.2005 · DOI: 10.1105/tpc.104.024950 Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice.2006 · DOI: 10.1038/nbt1173

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001766 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0008203 cholesterol metabolic process Biological Process

GO:0009647 skotomorphogenesis Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010268 brassinosteroid homeostasis Biological Process

GO:0010358 leaf shaping Biological Process

GO:0016125 sterol metabolic process Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0016135 saponin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT3G50660

dosa:Os04g0469800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.892

Rank 1 · TkA01G513140 · TK1151

Golgi apparatus0.059

Rank 2 · TkA01G513140 · TK1151

Cell membrane0.035

Rank 3 · TkA01G513140 · TK1151

Plastid0.035

Rank 4 · TkA01G513140 · TK1151

Cytoplasm0.034

Rank 5 · TkA01G513140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45043-468 aa

PF25334C2_GRDP140-189 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G513140	`PF00067`	p450	43	468	1.4e-59	202.8
TkA01G513140	`PF25334`	C2_GRDP	140	189	0.075	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64989`	Arabidopsis thaliana	sp\|O64989\|C90B1_ARATH Steroid (22S)-hydroxylase	43.500%	Swiss-Prot	Medium
`B8AV52`	Oryza sativa subsp. indica	sp\|B8AV52\|C724B_ORYSI Cytochrome P450 724B1	62.900%	Swiss-Prot	High
`Q6F4F5`	Oryza sativa subsp. japonica	sp\|Q6F4F5\|C724B_ORYSJ Cytochrome P450 724B1	62.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card