TkA01G496680 | RubberDandelionOmics

Gene overview

TkA01G496680

Reference: TK1151 Chr: Chr01 Coordinates: 124297488-124298712 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

503 bp · TkA01G496680|TK1151|cDNA

CATATTTATAAACTAAGAAACTTACAATCATTTTCTTTAGTAAAATGTGCAGTTATTGTATATCAAATTTGAGGTTGAGAAACTAGGACTAAAATTGAAGTTATTCGATACCATCTGATGACGAATACATAATGGCATCGTTAATGGCGGAACAAAGAGAGTTGACTGTTGATGTTGATGGTTTTAATGTTTCCATGAATGAAGCTAGAGAAAGATCAAGAAACGCACAAAATAAGCAAGCTGTTGTTACGGTTCTCATG...

CDS

Download CDS FASTA

372 bp · TkA01G496680|TK1151|CDS

ATGGCATCGTTAATGGCGGAACAAAGAGAGTTGACTGTTGATGTTGATGGTTTTAATGTTTCCATGAATGAAGCTAGAGAAAGATCAAGAAACGCACAAAATAAGCAAGCTGTTGTTACGGTTCTCATGGGTGCAACAGCACTGCATGAGTATGTGGAATGTGCTTCTGTTGGTGATGATGTTGGTATAATTCTTGAGAGCACAAATTTCTATGCTGAACAAGGTGGTCAGATATTTGATACCGGACTACTTGGAGGCCC...

Protein

Download Protein FASTA

123 aa · TkA01G496680|TK1151|PROTEIN

MASLMAEQRELTVDVDGFNVSMNEARERSRNAQNKQAVVTVLMGATALHEYVECASVGDDVGIILESTNFYAEQGGQIFDTGLLGGPSRTFKLLNVQLYAGYMEDYNDDGVPIVFPYSRNSRM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G496680`
TK1151 ID	TkA01G496680
OH-1004 ID	LXL04_024600
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	83.300
Protein coverage (%)	TK1151 97.561 / OH-1004 27.688 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G496680

Location Chr01:124297488-124298712 (-)

Description Similar to ALATS: Alanine--tRNA ligase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50200`	Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024600 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006419 alanyl-tRNA aminoacylation Biological Process

GO:0070143 mitochondrial alanyl-tRNA aminoacylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0002161 aminoacyl-tRNA deacylase activity Molecular Function

GO:0004813 alanine-tRNA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G50200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.466

Rank 1 · TkA01G496680 · TK1151

Cytoplasm0.386

Rank 2 · TkA01G496680 · TK1151

Cell membrane0.080

Rank 3 · TkA01G496680 · TK1151

Extracellular0.075

Rank 4 · TkA01G496680 · TK1151

Mitochondrion0.069

Rank 5 · TkA01G496680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01411tRNA-synt_2c2-39 aa

PF01411tRNA-synt_2c48-103 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G496680	`PF01411`	tRNA-synt_2c	2	39	2.9e-16	59.9
TkA01G496680	`PF01411`	tRNA-synt_2c	48	103	2.9e-16	59.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P36428`	Arabidopsis thaliana	sp\|P36428\|SYA_ARATH Alanine--tRNA ligase	44.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card