TkA01G483270 | RubberDandelionOmics

Gene overview

TkA01G483270

Reference: TK1151 Chr: Chr01 Coordinates: 120985698-120986490 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

435 bp · TkA01G483270|TK1151|cDNA

ATGGCGAGACCTCCTTCCAATATGGAATATTTTGGGCTTTCAGTCTTCATTCAAGAAGGAAAATGGTATCGCAATATTGTTCGCAGTGCATATTACGTTGCTCCAGAAGTGTTGAAGCGTAAATACGGAAACGAAATAGGTATATGGAGTGTAGGTGTGATGTTATACATCTTACTCAGTGGTGTACCTCCATTTTGGGCTGGAATATTTGACGAGATTCTGAAAAGCGAGATTGATTTCGAAAGCGAACCATGGCCATC...

CDS

Download CDS FASTA

435 bp · TkA01G483270|TK1151|CDS

ATGGCGAGACCTCCTTCCAATATGGAATATTTTGGGCTTTCAGTCTTCATTCAAGAAGGAAAATGGTATCGCAATATTGTTCGCAGTGCATATTACGTTGCTCCAGAAGTGTTGAAGCGTAAATACGGAAACGAAATAGGTATATGGAGTGTAGGTGTGATGTTATACATCTTACTCAGTGGTGTACCTCCATTTTGGGCTGGAATATTTGACGAGATTCTGAAAAGCGAGATTGATTTCGAAAGCGAACCATGGCCATC...

Protein

Download Protein FASTA

144 aa · TkA01G483270|TK1151|PROTEIN

MARPPSNMEYFGLSVFIQEGKWYRNIVRSAYYVAPEVLKRKYGNEIGIWSVGVMLYILLSGVPPFWAGIFDEILKSEIDFESEPWPSISTSAKHLVQRMLTLDPKKRITSAQVHEHPWIREDGEASDKPIDSAVLSRMKQFWID

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G483270`
TK1151 ID	TkA01G483270
OH-1004 ID	LXL04_014110
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.000
Protein coverage (%)	TK1151 92.361 / OH-1004 36.798 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G483270

Location Chr01:120985698-120986490 (+)

Description Similar to DPE1: 4-alpha-glucanotransferase DPE1, chloroplastic/amyloplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50700`	Ca(2+)-dependent protein kinase.	THI1, a Thiamine Thiazole Synthase, Interacts with Ca2+-Dependent Protein Kinase CPK33 and Modulates the S-Type Anion Channels and Stomatal Closure in Arabidopsis.2016 · DOI: 10.1104/pp.15.01649
`At3g20410`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0515100`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014110 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000025 maltose catabolic process Biological Process

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0006006 glucose metabolic process Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009501 amyloplast Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004134 4-alpha-glucanotransferase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT5G64860

dosa:Os07g0515100

dosa:Os07g0627000

osa:4343373

sot:102595076

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.606

Rank 1 · TkA01G483270 · TK1151

Nucleus0.542

Rank 2 · TkA01G483270 · TK1151

Cell membrane0.051

Rank 3 · TkA01G483270 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA01G483270 · TK1151

Mitochondrion0.040

Rank 5 · TkA01G483270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase11-119 aa

PF20513UBact92-106 aa

PF20513UBact126-140 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G483270	`PF00069`	Pkinase	11	119	2.5e-25	90.1
TkA01G483270	`PF20513`	UBact	92	106	0.15	12.6
TkA01G483270	`PF20513`	UBact	126	140	0.15	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C6P3`	Arabidopsis thaliana	sp\|Q9C6P3\|CDPKX_ARATH Calcium-dependent protein kinase 33	76.300%	Swiss-Prot	High
`Q38868`	Arabidopsis thaliana	sp\|Q38868\|CDPK9_ARATH Calcium-dependent protein kinase 9	75.600%	Swiss-Prot	High
`P53683`	Oryza sativa subsp. japonica	sp\|P53683\|CDPKJ_ORYSJ Calcium-dependent protein kinase 19	79.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card