TkA01G469460 | RubberDandelionOmics

Gene overview

TkA01G469460

Reference: TK1151 Chr: Chr01 Coordinates: 117503020-117504293 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1169 bp · TkA01G469460|TK1151|cDNA

TTTTCCCTCACGCTCTTGAAATCATGGAATCTAACGACATCATAGCACCTTTCGTCCTCAAAACCTATCAGATGGTCAACGACCCTTCGCTCGATGGCTTCATACGGTGGGGAATCGCCAGTAACAGCTTCATCGTCGTCGAACCCCTCGAATTCTCCCAACGTCTTTTGCCAGCTTACTTCAAACACAATAACTTCTCCAGCTTTGTTCGTCAACTGAACACTTATGGTTTCAGAAAAGTGGATCCTGATAGATGGGAG...

CDS

Download CDS FASTA

930 bp · TkA01G469460|TK1151|CDS

ATGGAATCTAACGACATCATAGCACCTTTCGTCCTCAAAACCTATCAGATGGTCAACGACCCTTCGCTCGATGGCTTCATACGGTGGGGAATCGCCAGTAACAGCTTCATCGTCGTCGAACCCCTCGAATTCTCCCAACGTCTTTTGCCAGCTTACTTCAAACACAATAACTTCTCCAGCTTTGTTCGTCAACTGAACACTTATGGTTTCAGAAAAGTGGATCCTGATAGATGGGAGTTTGCGAACGAGTGGTTTTTGAG...

Protein

Download Protein FASTA

309 aa · TkA01G469460|TK1151|PROTEIN

MESNDIIAPFVLKTYQMVNDPSLDGFIRWGIASNSFIVVEPLEFSQRLLPAYFKHNNFSSFVRQLNTYGFRKVDPDRWEFANEWFLRGQTHLLKNIERKRQINNRNFMRGEDDEEDEMAMEIARLKQEQKSLEQELVGMNKRLEATERRPDQMMALLHKVAEDPEILPRMMLEKDQRSKRLVKKKRQRILIPPSPPPSSSSRVKFKEEECQIMEGWAASSPEAYYGNEPFWQSPSTPSSDTPSMAWPKSKAGGGAVNMES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G469460`
TK1151 ID	TkA01G469460
OH-1004 ID	LXL04_002536
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G469460

Location Chr01:117503020-117504293 (+)

Description Similar to HSFC1: Heat stress transcription factor C-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24520`	Transcriptional regulator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0232000`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os01g0625300`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os06g0553100`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os07g0178600`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002536 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0005634 nucleus Cellular Component

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT3G24520

dosa:Os01g0625300

dosa:Os01g0733200

dosa:Os02g0232000

dosa:Os06g0553100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.963

Rank 1 · TkA01G469460 · TK1151

Cytoplasm0.123

Rank 2 · TkA01G469460 · TK1151

Cell membrane0.020

Rank 3 · TkA01G469460 · TK1151

Endoplasmic reticulum0.011

Rank 4 · TkA01G469460 · TK1151

Mitochondrion0.011

Rank 5 · TkA01G469460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00447HSF_DNA-bind10-99 aa

PF01496V_ATPase_I46-70 aa

PF15463ECM1170-141 aa

PF06589CRA88-144 aa

PF02414Borrelia_orfA92-176 aa

PF17675APG6_N93-149 aa

PF01496V_ATPase_I95-180 aa

PF17253DUF5320108-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G469460	`PF00447`	HSF_DNA-bind	10	99	9.2e-29	100.6
TkA01G469460	`PF01496`	V_ATPase_I	46	70	1.2	7.7
TkA01G469460	`PF15463`	ECM11	70	141	0.029	15.6
TkA01G469460	`PF06589`	CRA	88	144	0.047	14.4
TkA01G469460	`PF02414`	Borrelia_orfA	92	176	0.33	11.2
TkA01G469460	`PF17675`	APG6_N	93	149	3.6	8.8
TkA01G469460	`PF01496`	V_ATPase_I	95	180	1.2	7.7
TkA01G469460	`PF17253`	DUF5320	108	145	0.24	13.3
TkA01G469460	`PF04880`	NUDE_C	108	202	5.7	8.2
TkA01G469460	`PF26710`	Pde4dip	109	148	0.086	13.8
TkA01G469460	`PF04880`	NUDE_C	227	251	5.7	8.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV52`	Arabidopsis thaliana	sp\|Q9LV52\|HSFC1_ARATH Heat stress transcription factor C-1	69.600%	Swiss-Prot	Medium
`Q6EUG4`	Oryza sativa subsp. japonica	sp\|Q6EUG4\|HFC2A_ORYSJ Heat stress transcription factor C-2a	52.800%	Swiss-Prot	Medium
`Q6VBA4`	Oryza sativa subsp. japonica	sp\|Q6VBA4\|HFC1A_ORYSJ Heat stress transcription factor C-1a	49.300%	Swiss-Prot	Medium
`Q0DBL6`	Oryza sativa subsp. japonica	sp\|Q0DBL6\|HFC2B_ORYSJ Heat stress transcription factor C-2b	51.700%	Swiss-Prot	Medium
`Q6VBB2`	Oryza sativa subsp. japonica	sp\|Q6VBB2\|HFA2B_ORYSJ Heat stress transcription factor A-2b	48.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card