TkA01G454320 | RubberDandelionOmics

Gene overview

TkA01G454320

Reference: TK1151 Chr: Chr01 Coordinates: 113720132-113727267 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4296 bp · TkA01G454320|TK1151|cDNA

AGCACATGAAGCCTCATAAAGCATTGCCGCTTCACTCATCTCGAATCAAGCTGAACATTACGAAACATGGGCTAGTTTTATGCGTTTCAACTTTCAACGGTAAAACAAAAGATTTGAGCGACTGCGGATGACGATGCCGGTGCTGGGTGCAAGAATACCCTTGTGAGAGTCCGAGAGCACACTGTAAAACCTTGCAAAATCCTTATATAACTTGTCGAAACGAAAGAAATTTCCGACGAGCAATTAGACACCGGCGCAGC...

CDS

Download CDS FASTA

3153 bp · TkA01G454320|TK1151|CDS

ATGCCGGTGCTGGAAATTTCCGACGAGCAATTAGACACCGGCGCAGCCGACGGGAGCAAAAACCTAATTTTCGAGGCAATGACCTTTGTGTATATTCCGGTACAGAATTCGGAGGAGGAGGTTCGAGTCGCTCTGGACCAGCTTCCTAGAGACGCAACTGATATCCTTGATATTCTCAAGGCCGAACAAGCGCCTCTTGATCTCTGGCTCATTATCGCGAGAGAATACTTTAAACAAGGAAAAGTTGAACAGTTTCGCCA...

Protein

Download Protein FASTA

1050 aa · TkA01G454320|TK1151|PROTEIN

MPVLEISDEQLDTGAADGSKNLIFEAMTFVYIPVQNSEEEVRVALDQLPRDATDILDILKAEQAPLDLWLIIAREYFKQGKVEQFRQILEEGSSPEIDEYYADVRYERIAILNALGAYFSYLGKIETKQKEKEDYFILATQYYNKASRIDMHEPSTWVGKGQLLLAKGDVDQAFAAFKIVLDGDRDNVPALLGHACVEFNRGKYSNSLEMYKRVLQVYPECPAAVRLGIGLCRYKLGQFERAKQAFERLDPENVEALVAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G454320`
TK1151 ID	TkA01G454320
OH-1004 ID	LXL04_012774
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	95.700
Protein coverage (%)	TK1151 6.571 / OH-1004 46.309 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G454320

Location Chr01:113720132-113727267 (+)

Description Similar to VIP6: Protein CTR9 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g06210`	Component of the PAF1 complex (PAF1C) which is involved in histone modifications such as methylation on histone H3 'Lys-4' (H3K4me3).	A mechanism related to the yeast transcriptional regulator Paf1c is required for expression of the Arabidopsis FLC/MAF MADS box gene family.2004 · DOI: 10.1105/tpc.104.026062 PAF1-complex-mediated histone methylation of FLOWERING LOCUS C chromatin is required for the vernalization-responsive, winter-annual habit in Arabidopsis.2004 · DOI: 10.1101/gad.1244504 Identification of the Arabidopsis REDUCED DORMANCY 2 gene uncovers a role for the polymerase associated factor 1 complex in seed dormancy.2011 · DOI: 10.1371/journal.pone.0022241

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012774 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0009908 flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0016593 Cdc73/Paf1 complex Cellular Component

GO:0000993 RNA polymerase II complex binding Molecular Function

KEGG gene cross-reference

ath:AT2G06210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.722

Rank 1 · TkA01G454320 · TK1151

Cytoplasm0.212

Rank 2 · TkA01G454320 · TK1151

Endoplasmic reticulum0.057

Rank 3 · TkA01G454320 · TK1151

Golgi apparatus0.043

Rank 4 · TkA01G454320 · TK1151

Cell membrane0.037

Rank 5 · TkA01G454320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23914TPR_CcmH_CycH55-84 aa

PF13432TPR_1660-90 aa

PF14559TPR_1960-94 aa

PF12895ANAPC364-91 aa

PF13428TPR_1467-92 aa

PF13181TPR_867-91 aa

PF23220HAT_Syf1_M67-92 aa

PF00515TPR_168-83 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G454320	`PF23914`	TPR_CcmH_CycH	55	84	2.5e-23	83.4
TkA01G454320	`PF13432`	TPR_16	60	90	3.6e-39	133.5
TkA01G454320	`PF14559`	TPR_19	60	94	3.3e-36	124.1
TkA01G454320	`PF12895`	ANAPC3	64	91	4.6e-12	46.8
TkA01G454320	`PF13428`	TPR_14	67	92	9.2e-35	116.2
TkA01G454320	`PF13181`	TPR_8	67	91	1.9e-33	112.4
TkA01G454320	`PF23220`	HAT_Syf1_M	67	92	0.068	13.7
TkA01G454320	`PF00515`	TPR_1	68	83	7.6e-41	137.0
TkA01G454320	`PF07719`	TPR_2	68	83	3.5e-40	133.5
TkA01G454320	`PF25063`	ARM_TT21_C	69	90	4.9e-12	46.9
TkA01G454320	`PF29407`	CFAP70_TPR_C	70	92	1.9e-24	87.2
TkA01G454320	`PF13374`	TPR_10	72	91	3.8e-07	30.6
TkA01G454320	`PF13414`	TPR_11	74	84	6.6e-18	64.8
TkA01G454320	`PF13424`	TPR_12	100	126	4.7e-39	133.2
TkA01G454320	`PF13374`	TPR_10	110	125	3.8e-07	30.6
TkA01G454320	`PF13431`	TPR_17	111	129	1.2e-29	100.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B5X0I6`	Arabidopsis thaliana	sp\|B5X0I6\|VIP6_ARATH Protein CTR9 homolog	71.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card