TkA01G425900 | RubberDandelionOmics

Gene overview

TkA01G425900

Reference: TK1151 Chr: Chr01 Coordinates: 106311449-106313466 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1050 bp · TkA01G425900|TK1151|cDNA

ATGGCCACTTCTCTTCGTCTTTACAACCCATCAGAGAAGAAGGGTCCCCGCCGGAGAAGAATTGTTGTGAATAGAATCATCAGAGAAGAAGGAGCCTCGTCGGAGAAGAAGCTTAGGCGACCGACTGTGGCTTCGGTGTCCTGTGAAGCCCTTCCAGGCGGCTGTCTCCGTCGTCGCCACAAAACCACTAGCTGCGATGGCTGTGGTGGGTGCTGCTCAAGTAAAATGCTTATAGATCTATTAGTAATGTTTTCCTTTTA...

CDS

Download CDS FASTA

1050 bp · TkA01G425900|TK1151|CDS

ATGGCCACTTCTCTTCGTCTTTACAACCCATCAGAGAAGAAGGGTCCCCGCCGGAGAAGAATTGTTGTGAATAGAATCATCAGAGAAGAAGGAGCCTCGTCGGAGAAGAAGCTTAGGCGACCGACTGTGGCTTCGGTGTCCTGTGAAGCCCTTCCAGGCGGCTGTCTCCGTCGTCGCCACAAAACCACTAGCTGCGATGGCTGTGGTGGGTGCTGCTCAAGTAAAATGCTTATAGATCTATTAGTAATGTTTTCCTTTTA...

Protein

Download Protein FASTA

349 aa · TkA01G425900|TK1151|PROTEIN

MATSLRLYNPSEKKGPRRRRIVVNRIIREEGASSEKKLRRPTVASVSCEALPGGCLRRRHKTTSCDGCGGCCSSKMLIDLLVMFSFYSFSLVVEPNNHRRRLRFSVADRLSPSPTFCIWGWDIVEFFLGGTQSFSWCSVFPKDDPTLDKIDDKLLGIGRSSEGQRSIINGNTILLTKIPLVLLIDNGERTAELKSVFATFDKNKDGFITKQELSDSLKNIGISTSEKDVLEMVQRVDVNGDGLIDFDEFCELFESMMSRE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G425900`
TK1151 ID	TkA01G425900
OH-1004 ID	LXL04_002715
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 46.418 / OH-1004 68.354 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G425900

Location Chr01:106311449-106313466 (+)

Description Similar to CML4: Calmodulin-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07490`	Potential calcium sensor.	No verified direct reference in this release
`At4g12860`	Potential calcium sensor that is required for pollen tube attraction for ovule fertilization.	No verified direct reference in this release
`At2g43290`	Potential calcium sensor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0606600`	Potential calcium sensor.	No verified direct reference in this release
`Os12g0228800`	Potential calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002715 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G05990

ath:AT2G43290

ath:AT3G07490

ath:AT3G59440

dosa:Os04g0492800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.366

Rank 1 · TkA01G425900 · TK1151

Cytoplasm0.302

Rank 2 · TkA01G425900 · TK1151

Endoplasmic reticulum0.150

Rank 3 · TkA01G425900 · TK1151

Cell membrane0.146

Rank 4 · TkA01G425900 · TK1151

Plastid0.103

Rank 5 · TkA01G425900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17959EF-hand_14142-162 aa

PF30624EF_SSP120188-212 aa

PF23564EF-hand_FSTL1189-251 aa

PF21008AIF-1190-252 aa

PF00036EF-hand_1192-218 aa

PF13499EF-hand_7192-253 aa

PF13405EF-hand_6192-221 aa

PF13833EF-hand_8192-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G425900	`PF17959`	EF-hand_14	142	162	0.18	12.9
TkA01G425900	`PF30624`	EF_SSP120	188	212	0.00012	23.4
TkA01G425900	`PF23564`	EF-hand_FSTL1	189	251	4.1e-07	31.1
TkA01G425900	`PF21008`	AIF-1	190	252	0.00017	22.6
TkA01G425900	`PF00036`	EF-hand_1	192	218	1.3e-29	100.2
TkA01G425900	`PF13499`	EF-hand_7	192	253	3.3e-29	101.7
TkA01G425900	`PF13405`	EF-hand_6	192	221	5.8e-24	82.2
TkA01G425900	`PF13833`	EF-hand_8	192	218	1.4e-11	44.7
TkA01G425900	`PF24548`	EF_EFCAB10_C	192	230	1.4e-07	31.8
TkA01G425900	`PF25825`	SAPC2_N	192	257	4.2e-07	30.4
TkA01G425900	`PF13202`	EF-hand_5	193	214	5.3e-21	73.8
TkA01G425900	`PF05042`	Caleosin	193	224	0.028	15.1
TkA01G425900	`PF25578`	EF-hand_STIM1	193	217	4.2	8.3
TkA01G425900	`PF14658`	EF-hand_9	194	252	1.5e-10	42.1
TkA01G425900	`PF10591`	SPARC_Ca_bdg	194	251	4e-06	27.8
TkA01G425900	`PF17959`	EF-hand_14	196	237	0.18	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRR7`	Arabidopsis thaliana	sp\|Q9SRR7\|CML3_ARATH Calmodulin-like protein 3	52.000%	Swiss-Prot	Low
`Q9SU00`	Arabidopsis thaliana	sp\|Q9SU00\|CML2_ARATH Calmodulin-like protein 2	50.300%	Swiss-Prot	Low
`O22845`	Arabidopsis thaliana	sp\|O22845\|CML5_ARATH Calmodulin-like protein 5	45.400%	Swiss-Prot	Low
`Q0DZP5`	Oryza sativa subsp. japonica	sp\|Q0DZP5\|CML17_ORYSJ Probable calcium-binding protein CML17	43.900%	Swiss-Prot	Low
`Q2QVI1`	Oryza sativa subsp. japonica	sp\|Q2QVI1\|CML28_ORYSJ Probable calcium-binding protein CML28	42.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card