TkA01G399810 | RubberDandelionOmics

Gene overview

TkA01G399810

Reference: TK1151 Chr: Chr01 Coordinates: 99783881-99787315 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · TkA01G399810|TK1151|cDNA

ATGCCTTTCTCTCGATTAAATGATCTTAAAGAATGTGCAATTGCTTTTGACATCAAAGTTGCATGTTTTGCAGCAATATGGGTATATGAATCTCCATTAGCTCGGGCACTAAATCCTAAAGGACGTCATCTCAAAATAGTGAACCAATCTATAAAAATCCATCGTGAATGTTCCGATTTTGAACCAGTGCCACTCCCACGCACCATCTCCTCGTCGCCGGTCGCCGGTCGATCGCCACTCCTCCCTGAACCGATTTCGAC...

CDS

Download CDS FASTA

1236 bp · TkA01G399810|TK1151|CDS

ATGCCTTTCTCTCGATTAAATGATCTTAAAGAATGTGCAATTGCTTTTGACATCAAAGTTGCATGTTTTGCAGCAATATGGGTATATGAATCTCCATTAGCTCGGGCACTAAATCCTAAAGGACGTCATCTCAAAATAGTGAACCAATCTATAAAAATCCATCGTGAATGTTCCGATTTTGAACCAGTGCCACTCCCACGCACCATCTCCTCGTCGCCGGTCGCCGGTCGATCGCCACTCCTCCCTGAACCGATTTCGAC...

Protein

Download Protein FASTA

411 aa · TkA01G399810|TK1151|PROTEIN

MPFSRLNDLKECAIAFDIKVACFAAIWVYESPLARALNPKGRHLKIVNQSIKIHRECSDFEPVPLPRTISSSPVAGRSPLLPEPISTAASAPPPLPNRFAAVRLLVSLRHPSQHFHELHLSYVAFDLNGSRHEEDILTEIAKYLDGKSLVMLAATRKWFLRVVMDESVWKFACLRDLQVLIALKQHLNGSNFMLQLLVEVILMIFVRRRSILLVRCPVCDLNTCDGIMQVLDVRHMELFLTEEYQKGSWEYKLIGSHDIR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G399810`
TK1151 ID	TkA01G399810
OH-1004 ID	LXL04_001837
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	66.400
Protein coverage (%)	TK1151 71.776 / OH-1004 31.277 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G399810

Location Chr01:99783881-99787315 (-)

Description Similar to Exopolygalacturonase (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61730`	Regulates tapetum degeneration and pollen maturation during anther development.	No verified direct reference in this release
`At5g36000`	Probable F-box protein At5g36000.	No verified direct reference in this release
`At5g60600`	Enzyme of the plastid non-mevalonate pathway for isoprenoid biosynthesis that converts 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (ME-2,4cPP) into 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate.	CHLOROPLAST BIOGENESIS genes act cell and noncell autonomously in early chloroplast development.2004 · DOI: 10.1104/pp.103.036996 The Arabidopsis csb3 mutant reveals a regulatory link between salicylic acid-mediated disease resistance and the methyl-erythritol 4-phosphate pathway.2005 · DOI: 10.1111/j.1365-313x.2005.02517.x Isoprenoid biosynthesis in plant chloroplasts via the MEP pathway: direct thylakoid/ferredoxin-dependent photoreduction of GcpE/IspG.2006 · DOI: 10.1016/j.febslet.2006.01.082

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0603800`	Enzyme of the plastid non-mevalonate pathway for isoprenoid biosynthesis that converts 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (ME-2,4cPP) into 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001837 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0004650 polygalacturonase activity Molecular Function

GO:0047911 galacturan 1,4-alpha-galacturonidase activity Molecular Function

KEGG gene cross-reference

ath:AT3G07850

ghi:107942091

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.443

Rank 1 · TkA01G399810 · TK1151

Cytoplasm0.337

Rank 2 · TkA01G399810 · TK1151

Cell membrane0.116

Rank 3 · TkA01G399810 · TK1151

Endoplasmic reticulum0.106

Rank 4 · TkA01G399810 · TK1151

Mitochondrion0.090

Rank 5 · TkA01G399810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23692YmjE88-99 aa

PF12937F-box-like135-175 aa

PF12937F-box-like199-216 aa

PF23692YmjE295-313 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G399810	`PF23692`	YmjE	88	99	0.43	11.3
TkA01G399810	`PF12937`	F-box-like	135	175	0.00087	19.7
TkA01G399810	`PF12937`	F-box-like	199	216	0.00087	19.7
TkA01G399810	`PF23692`	YmjE	295	313	0.43	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M365`	Arabidopsis thaliana	sp\|Q9M365\|FB331_ARATH Probable F-box protein At3g61730	41.800%	Swiss-Prot	Low
`Q9FGB8`	Arabidopsis thaliana	sp\|Q9FGB8\|FB332_ARATH Probable F-box protein At5g36000	40.200%	Swiss-Prot	Low
`F4K0E8`	Arabidopsis thaliana	sp\|F4K0E8\|ISPG_ARATH 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic	63.500%	Swiss-Prot	Low
`Q6K8J4`	Oryza sativa subsp. japonica	sp\|Q6K8J4\|ISPG_ORYSJ 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic	60.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card