TkA01G387880 | RubberDandelionOmics

Gene overview

TkA01G387880

Reference: TK1151 Chr: Chr01 Coordinates: 96807256-96809198 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1857 bp · TkA01G387880|TK1151|cDNA

TATAAGTGTTGTTTTATATTCTATTAGCTGTAACTTTGATACTCTCCCAAGTCCCAACTTTGTTTGTGTTGGAAAATTTAAAAGTTTGGTTATGGACTTTTAGCTACGAATTTTGGGGTCGTGATACAGATTTTGTTTTGTAGTGATTGCAGTTTACTCTACAAAATTAGTATACAACTTTCCAATACAGATGTGGTCGAAACTTATTTGTTACATTGACTTTAAACCAATATTCGGAAATCGTGAAAGACGTGGTTCAC...

CDS

Download CDS FASTA

1059 bp · TkA01G387880|TK1151|CDS

ATGTACGGAGACAACATTTGCCCAACTAACAAGCTTTGTACCACCCCTGTTTCTTGCGAGGAATATCAATGCACGGATGTCCGGACCACTTACTCTTACGATGGTCCTTCATGCCCGGCTGTAACCAACAGTTACACGTTACCTGGTTGGGGATTATGCACATGCCCTGTTAATATCATCAACCCGTTAAACGGAATGTGCACTCAAGTCGAGCTCAATTCCGATACTTTTGAAGCAAACACAACTAACGGAAGAAACCC...

Protein

Download Protein FASTA

352 aa · TkA01G387880|TK1151|PROTEIN

MYGDNICPTNKLCTTPVSCEEYQCTDVRTTYSYDGPSCPAVTNSYTLPGWGLCTCPVNIINPLNGMCTQVELNSDTFEANTTNGRNPFHVFQDIILNAACAPSSSFESFPVNVSGVMAFSTSPYALPASFFQSELKTSFALCLPSNSSVPGILFFGDGPFYLLPHSDSDVRGLLSYTPLLKHPDSFGYFIGVNDVVIRGRSINISENTTAKLSTTEPYTTLRTDIYERMVRRFSKVTKRMPLVTPVAPFGLCFRTLENET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G387880`
TK1151 ID	TkA01G387880
OH-1004 ID	LXL04_023249
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.100
Protein coverage (%)	TK1151 99.432 / OH-1004 79.812 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G387880

Location Chr01:96807256-96809198 (-)

Description Similar to GIP2: Probable aspartic proteinase GIP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0937050`	Chitinase that possesses antifungal activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023249 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0006032 chitin catabolic process Biological Process

GO:0006508 proteolysis Biological Process

GO:0006952 defense response Biological Process

GO:0048364 root development Biological Process

GO:0048367 shoot system development Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0008843 endochitinase activity Molecular Function

GO:0019863 IgE binding Molecular Function

KEGG gene cross-reference

dosa:Os01g0937050

gmx:547485

osa:9267890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.334

Rank 1 · TkA01G387880 · TK1151

Cell membrane0.253

Rank 2 · TkA01G387880 · TK1151

Endoplasmic reticulum0.132

Rank 3 · TkA01G387880 · TK1151

Cytoplasm0.109

Rank 4 · TkA01G387880 · TK1151

Lysosome / Vacuole0.092

Rank 5 · TkA01G387880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14543TAXi_N14-157 aa

PF14541TAXi_C188-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G387880	`PF14543`	TAXi_N	14	157	9.1e-15	56.0
TkA01G387880	`PF14541`	TAXi_C	188	334	9.7e-41	140.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S1V1`	Oryza sativa subsp. japonica	sp\|Q8S1V1\|CLP_ORYSJ Chitinase CLP	35.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card