TkA01G383910 | RubberDandelionOmics

Gene overview

TkA01G383910

Reference: TK1151 Chr: Chr01 Coordinates: 95821042-95830406 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1571 bp · TkA01G383910|TK1151|cDNA

CAAAGCATATATTTAATATAAAATTAACTGATTTTAATCGACAAAAAGGGTTTAAAGCAAAAGAGGGATCAATTGAAATCGTTTGCTTCTCTCTACAGACGCATGAAGAAACCCGAACAAACAAAGACATCAAAACACGAAGATGAGGTCGATTTCATCAGTAACATGCCAGATCATATTCTTCTCTTGATTCTTTCACATATTTTCTCTACTGAAGAAGTAATTCGAACCAGCATCTTGTCCACACGATGGAAGTATTT...

CDS

Download CDS FASTA

1407 bp · TkA01G383910|TK1151|CDS

ATGAAGGAATTAATGCAAGCAAAAGCATCAGGTCGTGAAGATGAGGTGGACAAGATCAGTAACTTACCAGATCCAATTCTTCACCTGATTCTTTCACATCTTCCAGCTACCGAAGAAGCAATTCGAACCAGCATTTTGTCGAGAAGATGGAGGCATCTATGGACTTCAGTTCCATCAATCGACATAGATTATGCCCGAGGACTGAAACCTGCAAAAGGATTCGAAAGAAACAAATTCAAAGAGTTTGTGTCTTCGGTTTT...

Protein

Download Protein FASTA

468 aa · TkA01G383910|TK1151|PROTEIN

MKELMQAKASGREDEVDKISNLPDPILHLILSHLPATEEAIRTSILSRRWRHLWTSVPSIDIDYARGLKPAKGFERNKFKEFVSSVLANKSLDLDSFRLICCDFYSMSTVGQWIDTAITKNVKLLYLLFWPWVESQDIEVNCGSLEVLKLFLFGRRLSLLSLTGFSSLKVLKLDSVELCSDDFVKDFLKSCPLLEDLSLKDCLLNQLNVLCISCPNLKTLYIDNLFDFEEICAHEGLGDGPMEIQISCPKLVVLELTAHI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G383910`
TK1151 ID	TkA01G383910
OH-1004 ID	LXL04_026956
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	49.900
Protein coverage (%)	TK1151 98.718 / OH-1004 94.549 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G383910

Location Chr01:95821042-95830406 (-)

Description Similar to At1g78760: Putative F-box/FBD/LRR-repeat protein At1g78760

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56370`	FBD-associated F-box protein At5g56370.	No verified direct reference in this release
`At1g69630`	F-box/LRR-repeat protein 13.	No verified direct reference in this release
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release
`At5g25850`	Putative F-box/FBD/LRR-repeat protein At5g25850.	No verified direct reference in this release
`At5g56560`	Putative FBD-associated F-box protein At5g56560.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026956 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G66290

ath:AT1G66310

ath:AT1G69630

ath:AT1G78750

ath:AT1G78760

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.864

Rank 1 · TkA01G383910 · TK1151

Cytoplasm0.205

Rank 2 · TkA01G383910 · TK1151

Endoplasmic reticulum0.033

Rank 3 · TkA01G383910 · TK1151

Cell membrane0.033

Rank 4 · TkA01G383910 · TK1151

Plastid0.015

Rank 5 · TkA01G383910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box19-58 aa

PF12937F-box-like19-53 aa

PF08387FBD79-89 aa

PF23622LRR_At1g61320_AtMIF190-438 aa

PF00646F-box93-107 aa

PF24758LRR_At5g56370111-231 aa

PF12799LRR_4153-174 aa

PF27094DUF8346166-223 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G383910	`PF00646`	F-box	19	58	7e-09	36.0
TkA01G383910	`PF12937`	F-box-like	19	53	6.6e-05	23.3
TkA01G383910	`PF08387`	FBD	79	89	0.00092	19.8
TkA01G383910	`PF23622`	LRR_At1g61320_AtMIF1	90	438	2.4e-11	44.4
TkA01G383910	`PF00646`	F-box	93	107	7e-09	36.0
TkA01G383910	`PF24758`	LRR_At5g56370	111	231	2.7e-13	50.8
TkA01G383910	`PF12799`	LRR_4	153	174	0.55	11.3
TkA01G383910	`PF27094`	DUF8346	166	223	0.18	11.0
TkA01G383910	`PF08387`	FBD	183	198	0.00092	19.8
TkA01G383910	`PF12799`	LRR_4	186	209	0.55	11.3
TkA01G383910	`PF12799`	LRR_4	194	225	0.55	11.3
TkA01G383910	`PF08387`	FBD	201	213	0.00092	19.8
TkA01G383910	`PF24758`	LRR_At5g56370	247	282	2.7e-13	50.8
TkA01G383910	`PF12799`	LRR_4	247	257	0.55	11.3
TkA01G383910	`PF08387`	FBD	264	278	0.00092	19.8
TkA01G383910	`PF27094`	DUF8346	266	314	0.18	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FM94`	Arabidopsis thaliana	sp\|Q9FM94\|FBD21_ARATH FBD-associated F-box protein At5g56370	30.500%	Swiss-Prot	Medium
`Q9FWZ1`	Arabidopsis thaliana	sp\|Q9FWZ1\|FBL13_ARATH F-box/LRR-repeat protein 13	31.900%	Swiss-Prot	Medium
`Q9FM89`	Arabidopsis thaliana	sp\|Q9FM89\|FDL38_ARATH F-box/FBD/LRR-repeat protein At5g56420	29.200%	Swiss-Prot	Low
`Q3E944`	Arabidopsis thaliana	sp\|Q3E944\|FDL33_ARATH Putative F-box/FBD/LRR-repeat protein At5g25850	27.000%	Swiss-Prot	Low
`Q9FJV2`	Arabidopsis thaliana	sp\|Q9FJV2\|FBD27_ARATH Putative FBD-associated F-box protein At5g56560	30.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card