TkA01G367360 | RubberDandelionOmics

Gene overview

TkA01G367360

Reference: TK1151 Chr: Chr01 Coordinates: 91550872-91554870 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2491 bp · TkA01G367360|TK1151|cDNA

CTCGCACACCCCACAACAACAAGGCGTGCAATCACATCTTACAGAATAATTCACAGGCTTCTTTGTCAAAGTTGTGGGGTTCCAAGCAAACTACTACCCACACATACACACCTGTTCTAGACTAACCTCACCCTTCTTTTTTTAGATCAGCTTTTTTCATGTGACTCTGCTGTTATTCGATGCATTTACATATTGGTATGAGAAATTTTGGTTTTGGATGATTAAAATTGGTGAAATTGTTGATGAAGTGTGATTGTGAG...

CDS

Download CDS FASTA

1887 bp · TkA01G367360|TK1151|CDS

ATGGATCGCCGGAGCTGGCTATGGCGGAGGAGGTCGTCGGAAAAAAGCCCCGGTGAAACAGAAAGCTCTGGAGGATCAGTTTCTTCTCACTCTGAGCGATTTTCTGACGATCAGATATATTCAAATCAAAGTTCTATGTCACCTGATGTCACATCAAAGTCTGAACCACCAGTGGAAGAAATCGAGGGTGGTGTCAAGACTTTATCTGAGAAACTATCAGCAGCTCTTGTGAATATCAGTATGAAGGAGGACTTGGTAAA...

Protein

Download Protein FASTA

628 aa · TkA01G367360|TK1151|PROTEIN

MDRRSWLWRRRSSEKSPGETESSGGSVSSHSERFSDDQIYSNQSSMSPDVTSKSEPPVEEIEGGVKTLSEKLSAALVNISMKEDLVKQHSKVAEEAVEGWEKAENEVLGLRQQIEVLTLRNSTLEDRVCQLDGALKECLRQLRQTREEKDQKINEIIEKKTSEWQATKSQLENQLTELRSAKKTDPFSTQKLEKENSALKLELASMAEELEIRLIERELSNQAAESASKLHLESVKKTAKLESECRKLNAALRKALIVND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G367360`
TK1151 ID	TkA01G367360
OH-1004 ID	LXL04_030378
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	31.600
Protein coverage (%)	TK1151 97.930 / OH-1004 85.880 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G367360

Location Chr01:91550872-91554870 (-)

Description Similar to FPP: Filament-like plant protein (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05270`	Ensures, when in complex with COG2 and FPP2/VETH2, the correct secondary cell wall (SCW) deposition pattern by recruiting exocyst components to cortical microtubules in xylem cells during secondary cell wall deposition by recruiting EXO70A1.	No verified direct reference in this release
`At1g77580`	Filament-like plant protein 1.	No verified direct reference in this release
`At1g21810`	Ensures, when in complex with FPP3/VETH1 and COG2, the correct secondary cell wall (SCW) deposition pattern by recruiting exocyst components to cortical microtubules in xylem cells during secondary cell wall deposition by recruiting EXO70A1.	No verified direct reference in this release
`At1g19835`	Filament-like plant protein 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030378 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0060178 regulation of exocyst localization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0031410 cytoplasmic vesicle Cellular Component

GO:0030674 protein-macromolecule adaptor activity Molecular Function

KEGG gene cross-reference

ath:AT1G21810

ath:AT1G77580

ath:AT3G05270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.573

Rank 1 · TkA01G367360 · TK1151

Cell membrane0.254

Rank 2 · TkA01G367360 · TK1151

Nucleus0.247

Rank 3 · TkA01G367360 · TK1151

Golgi apparatus0.058

Rank 4 · TkA01G367360 · TK1151

Plastid0.052

Rank 5 · TkA01G367360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05911FPP22-46 aa

PF23649FKBP1553-210 aa

PF30679CCDC18_2nd53-243 aa

PF30828CEP83_CC_1st53-181 aa

PF25764KIF21A_4th54-206 aa

PF24161CCDC3958-250 aa

PF06818Fez158-122 aa

PF27605ODF2_C62-146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G367360	`PF05911`	FPP	22	46	2.2e-74	251.9
TkA01G367360	`PF23649`	FKBP15	53	210	0.00035	21.0
TkA01G367360	`PF30679`	CCDC18_2nd	53	243	0.91	8.3
TkA01G367360	`PF30828`	CEP83_CC_1st	53	181	1.5	8.6
TkA01G367360	`PF25764`	KIF21A_4th	54	206	0.11	12.9
TkA01G367360	`PF24161`	CCDC39	58	250	0.0024	16.5
TkA01G367360	`PF06818`	Fez1	58	122	0.004	18.4
TkA01G367360	`PF27605`	ODF2_C	62	146	0.0049	16.8
TkA01G367360	`PF10534`	CRIC_ras_sig	66	108	6.6	7.7
TkA01G367360	`PF05911`	FPP	82	179	2.2e-74	251.9
TkA01G367360	`PF00261`	Tropomyosin	91	255	0.00034	20.8
TkA01G367360	`PF05266`	DUF724	99	168	4.3	7.9
TkA01G367360	`PF06818`	Fez1	134	271	0.004	18.4
TkA01G367360	`PF27605`	ODF2_C	140	253	0.0049	16.8
TkA01G367360	`PF13801`	Metal_resist	147	199	1.3	9.9
TkA01G367360	`PF22937`	PDXDC1-like_cen2	158	211	0.14	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MA92`	Arabidopsis thaliana	sp\|Q9MA92\|FPP3_ARATH Filament-like plant protein 3	34.800%	Swiss-Prot	Medium
`Q9CAP9`	Arabidopsis thaliana	sp\|Q9CAP9\|FPP1_ARATH Filament-like plant protein 1	42.100%	Swiss-Prot	Low
`Q9SFF4`	Arabidopsis thaliana	sp\|Q9SFF4\|FPP2_ARATH Filament-like plant protein 2	36.600%	Swiss-Prot	Low
`Q0WSY2`	Arabidopsis thaliana	sp\|Q0WSY2\|FPP4_ARATH Filament-like plant protein 4	36.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card