Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2733 bp · TkA01G215060|TK1151|cDNA
ATCAGTTACCGCCTCAAAGAAACCCTCTCTTCCACCTCCAGCGCCTTGCCTGAGCTCGGCCACAGTCCAGAGTCGAGGACTTGGACCGAGCCTTAGATCGAGACGCGCACGCCGGCTGCTTGCCGTCATCGCCGCATCCTGGCCATCTGATCGCCGACATCTCATCCCTATTTCCCCGTGAAGTCGACCTCCTTCTCCGGCGGTGACCAAGGATAAATGGGGAAAAAGGCTAAGAAGAAAGCAATCCGAAATGCTCAAAA...
2262 bp · TkA01G215060|TK1151|CDS
ATGGGGAAAAAGGCTAAGAAGAAAGCAATCCGAAATGCTCAAAAGGAGAAACAGTTACCAACCTCTTCTCCAAACACCATTTCACAAAAGATTCCAACAGATGGAGGTTCAGTTGTAAAAGAAACCATACTATGTCCTCATATTGATAAAGGCATTAATTTGGATAAAGTCTCCTCAAAGATAACATCACTCGAGTCTCCTAAATGTGAAGATTGTAGGGAAGGAGTAGTTGATAAAAGATCAAGTAAATCAAAAGGCAA...
Protein
Download Protein FASTA753 aa · TkA01G215060|TK1151|PROTEIN
MGKKAKKKAIRNAQKEKQLPTSSPNTISQKIPTDGGSVVKETILCPHIDKGINLDKVSSKITSLESPKCEDCREGVVDKRSSKSKGKHVKKKGGGTSTTSDSKSIWVCLECGQFTCGGIGFPTTPHTHATRHSKLNHHPLAIQLTNPNLRFCFPCNTLIPVQISEENGEQKDAFSSIVKVLKTPPSSEKNSLDVEDIWFGNGSIISEVKVKPVNTQISVENIGGFYIVKGLNNLGNTCFFNSILQNLLAMDKLRDHFLKL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G215060 |
|---|---|
| TK1151 ID | TkA01G215060 |
| OH-1004 ID | LXL04_004009 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 94.400 |
| Protein coverage (%) | TK1151 98.141 / OH-1004 88.305Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G215060 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:54797888-54801230 (+) | |||||||||
| Description | Similar to UBP2: Ubiquitin carboxyl-terminal hydrolase 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006508 proteolysis Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0016579 protein deubiquitination Biological Process GO:0031647 regulation of protein stability Biological Process GO:0035520 monoubiquitinated protein deubiquitination Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0051289 protein homotetramerization Biological Process GO:0051301 cell division Biological Process GO:0051726 regulation of cell cycle Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G04860 ath:AT2G32780 bta:519992 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01927Mut7-C66-113 aaPF01780Ribosomal_L37ae78-131 aaPF30462DUF861783-114 aaPF17807zf-UBP_var98-144 aaPF02148zf-UBP100-157 aaPF01927Mut7-C145-160 aaPF00443UCH230-750 aaPF13423UCH_1230-254 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G215060 | PF01927 | Mut7-C | 66 | 113 | 7.2 | 7.4 |
| TkA01G215060 | PF01780 | Ribosomal_L37ae | 78 | 131 | 0.35 | 11.7 |
| TkA01G215060 | PF30462 | DUF8617 | 83 | 114 | 4.7 | 8.4 |
| TkA01G215060 | PF17807 | zf-UBP_var | 98 | 144 | 0.61 | 10.6 |
| TkA01G215060 | PF02148 | zf-UBP | 100 | 157 | 6.3e-12 | 46.3 |
| TkA01G215060 | PF01927 | Mut7-C | 145 | 160 | 7.2 | 7.4 |
| TkA01G215060 | PF00443 | UCH | 230 | 750 | 5.4e-56 | 190.7 |
| TkA01G215060 | PF13423 | UCH_1 | 230 | 254 | 4.2e-09 | 37.2 |
| TkA01G215060 | PF17807 | zf-UBP_var | 294 | 315 | 0.61 | 10.6 |
| TkA01G215060 | PF13423 | UCH_1 | 314 | 386 | 4.2e-09 | 37.2 |
| TkA01G215060 | PF30462 | DUF8617 | 349 | 358 | 4.7 | 8.4 |
| TkA01G215060 | PF02148 | zf-UBP | 352 | 358 | 6.3e-12 | 46.3 |
| TkA01G215060 | PF01927 | Mut7-C | 446 | 464 | 7.2 | 7.4 |
| TkA01G215060 | PF17807 | zf-UBP_var | 519 | 544 | 0.61 | 10.6 |
| TkA01G215060 | PF30462 | DUF8617 | 525 | 565 | 4.7 | 8.4 |
| TkA01G215060 | PF01927 | Mut7-C | 545 | 565 | 7.2 | 7.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.