TkA01G208300 | RubberDandelionOmics

Gene overview

TkA01G208300

Reference: TK1151 Chr: Chr01 Coordinates: 52999147-53000241 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

717 bp · TkA01G208300|TK1151|cDNA

AAAAGCCTCGTTACCCAAACACTCATCGTCATTTTTCGAAATTAGGGTTTGAGATTTCAGCTGCGGCTCATTCAACTATCGCATAATCCATGGCTCGGATCAAAGTTCATGAGTTGAGGGACAAATCCAAGGTTGATTTGTTTGCTCAGTTGAAGGATCTTAAGGCTGACTCGCTCTTCTCTCTTCTCCTTGTCGCCAAAGTCACCGGCGGTGCTCCCAACAAGCTCTCCAAAATAAAAGTGGTGAGGACATCAATTGCA...

CDS

Download CDS FASTA

378 bp · TkA01G208300|TK1151|CDS

ATGGCTCGGATCAAAGTTCATGAGTTGAGGGACAAATCCAAGGTTGATTTGTTTGCTCAGTTGAAGGATCTTAAGGCTGACTCGCTCTTCTCTCTTCTCCTTGTCGCCAAAGTCACCGGCGGTGCTCCCAACAAGCTCTCCAAAATAAAAGTGGTGAGGACATCAATTGCACAGGTGCTGACTGTTATTTCACAGACACAGAAAGCGAAACTCAGGGAAGCCTACAAGACCAAGAATTACTTACCTCTTGATTTGCGTCC...

Protein

Download Protein FASTA

125 aa · TkA01G208300|TK1151|PROTEIN

MARIKVHELRDKSKVDLFAQLKDLKADSLFSLLLVAKVTGGAPNKLSKIKVVRTSIAQVLTVISQTQKAKLREAYKTKNYLPLDLRPKKTRAIRRRLTKHQVSLKTEREKKKEKYFPLRKYAIKV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G208300`
TK1151 ID	TkA01G208300
OH-1004 ID	LXL04_021983
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.800
Protein coverage (%)	TK1151 87.200 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G208300

Location Chr01:52999147-53000241 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39390`	Large ribosomal subunit protein uL29y.	No verified direct reference in this release
`At5g02610`	Large ribosomal subunit protein uL29w.	No verified direct reference in this release
`At3g09500`	Large ribosomal subunit protein uL29z.	No verified direct reference in this release
`At3g55170`	Large ribosomal subunit protein uL29x.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021983 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0006412 translation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G39390

ath:AT3G09500

ath:AT3G55170

ath:AT5G02610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.831

Rank 1 · TkA01G208300 · TK1151

Nucleus0.190

Rank 2 · TkA01G208300 · TK1151

Endoplasmic reticulum0.052

Rank 3 · TkA01G208300 · TK1151

Mitochondrion0.036

Rank 4 · TkA01G208300 · TK1151

Plastid0.034

Rank 5 · TkA01G208300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00831Ribosomal_L298-65 aa

PF00831Ribosomal_L2986-96 aa

PF00831Ribosomal_L29104-119 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G208300	`PF00831`	Ribosomal_L29	8	65	9.6e-11	42.2
TkA01G208300	`PF00831`	Ribosomal_L29	86	96	9.6e-11	42.2
TkA01G208300	`PF00831`	Ribosomal_L29	104	119	9.6e-11	42.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80626`	Arabidopsis thaliana	sp\|O80626\|RL352_ARATH Large ribosomal subunit protein uL29y	82.400%	Swiss-Prot	High
`Q9LZ41`	Arabidopsis thaliana	sp\|Q9LZ41\|RL354_ARATH Large ribosomal subunit protein uL29w	83.200%	Swiss-Prot	High
`Q9SF53`	Arabidopsis thaliana	sp\|Q9SF53\|RL351_ARATH Large ribosomal subunit protein uL29z	82.400%	Swiss-Prot	High
`Q9M3D2`	Arabidopsis thaliana	sp\|Q9M3D2\|RL353_ARATH Large ribosomal subunit protein uL29x	81.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card