TkA01G184800 | RubberDandelionOmics

Gene overview

TkA01G184800

Reference: TK1151 Chr: Chr01 Coordinates: 47423431-47428810 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4059 bp · TkA01G184800|TK1151|cDNA

ATGCAATTCGCTGATGCTCAACATCATTATATAGTTGTTCAACTTGAGGGAACTTCTACACTTTCGGCTCCTGTTTCTATTGATCTTGTTGGTGTCAGCTTCTTTGAGGTGGATTTTTCTACTAATATAGGACTTGATGTTTCTAAAGGTGGCTATGTTGTTCCTGTAGTAATCGATGTTTCAGTCCAACGGGTAATAAACAAGAGGGGATCATCTTCATCTCTCTATAATATTAATACTCATGATCATGTTGACAAGAT...

CDS

Download CDS FASTA

3261 bp · TkA01G184800|TK1151|CDS

ATGCAATTCGCTGATGCTCAACATCATTATATAGTTGTTCAACTTGAGGGAACTTCTACACTTTCGGCTCCTGTTTCTATTGATCTTGTTGGTGTCAGCTTCTTTGAGGTGGATTTTTCTACTAATATAGGACTTGATGTTTCTAAAGGTGGCTATGTTGTTCCTGTAGTAATCGATGTTTCAGTCCAACGGGTAATAAACAAGAGGGGATCATCTTCATCTCTCTATAATATTAATACTCATGATCATGTTGACAAGAT...

Protein

Download Protein FASTA

1086 aa · TkA01G184800|TK1151|PROTEIN

MQFADAQHHYIVVQLEGTSTLSAPVSIDLVGVSFFEVDFSTNIGLDVSKGGYVVPVVIDVSVQRVINKRGSSSSLYNINTHDHVDKIENQDLSNKRCIHLITLSNPLIVKNYLPVEVSVVIESGGVSRSMLLSEVETFFYHIDSSHDLSLTFEIRGFRPSLLKFPRAEKFSGIAKFSGTKFSSSESINFAADNSKGPLYVTMEKVMDAFSGAREICIFVPFLLYNCCGFPLMIANSTNDHTMRDTLPSCYDLDEEDPFLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G184800`
TK1151 ID	TkA01G184800
OH-1004 ID	LXL04_026198
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	18.600
Protein coverage (%)	TK1151 55.985 / OH-1004 12.763 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G184800`
Location	Chr01:47423431-47428810 (-)
Description	Similar to vps13A: Putative vacuolar protein sorting-associated protein 13A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_026198` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006623 protein targeting to vacuole Biological Process GO:0006869 lipid transport Biological Process GO:0007005 mitochondrion organization Biological Process GO:0045053 protein retention in Golgi apparatus Biological Process GO:0045324 late endosome to vacuole transport Biological Process GO:0120009 intermembrane lipid transfer Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005811 lipid droplet Cellular Component GO:0016020 membrane Cellular Component GO:0005543 phospholipid binding Molecular Function GO:0120014 phospholipid transfer activity Molecular Function
KEGG gene cross-reference	cthr:CTHT_0020450 ddi:DDB_G0274917 ddi:DDB_G0286725 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.319

Rank 1 · TkA01G184800 · TK1151

Cytoplasm0.318

Rank 2 · TkA01G184800 · TK1151

Endoplasmic reticulum0.191

Rank 3 · TkA01G184800 · TK1151

Nucleus0.130

Rank 4 · TkA01G184800 · TK1151

Cell membrane0.126

Rank 5 · TkA01G184800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25036VPS13_VAB59-579 aa

PF25036VPS13_VAB702-755 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G184800	`PF25036`	VPS13_VAB	59	579	2.8e-32	112.7
TkA01G184800	`PF25036`	VPS13_VAB	702	755	2.8e-32	112.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card