LXL04_026198 | RubberDandelionOmics

Gene overview

LXL04_026198

Reference: OH-1004 Chr: Chr05 Coordinates: 122623899-122648246 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

12672 bp · LXL04_026198|LXL04_026198|OH1004|cDNA

ATGTTAGAGGATCAAGTAGCGAATTTGTTACAGAGGTACCTCGGCAACTATGTCCGTGGCCTCAGCAAAGAAGCTCTCAAAATCAGCGTCTGGCAGGGCGATGTAGAGTTAACAAATATGCAACTGAAGCCTGAGGCACTCAATGCGCTGAAGTTGCCTGTAAAGGTCAAGGCTGGGTTCCTTGGATCAGTGAAGCTCAAGGTTCCTTGGAGCAGGATTGGTCAAGAACCAGTTTTGGTGTACTTAGATCGTATATATTT...

CDS

Download CDS FASTA

12672 bp · LXL04_026198|LXL04_026198|OH1004|CDS

ATGTTAGAGGATCAAGTAGCGAATTTGTTACAGAGGTACCTCGGCAACTATGTCCGTGGCCTCAGCAAAGAAGCTCTCAAAATCAGCGTCTGGCAGGGCGATGTAGAGTTAACAAATATGCAACTGAAGCCTGAGGCACTCAATGCGCTGAAGTTGCCTGTAAAGGTCAAGGCTGGGTTCCTTGGATCAGTGAAGCTCAAGGTTCCTTGGAGCAGGATTGGTCAAGAACCAGTTTTGGTGTACTTAGATCGTATATATTT...

Protein

Download Protein FASTA

4223 aa · LXL04_026198|LXL04_026198|OH1004|PROTEIN

MLEDQVANLLQRYLGNYVRGLSKEALKISVWQGDVELTNMQLKPEALNALKLPVKVKAGFLGSVKLKVPWSRIGQEPVLVYLDRIYLLAEPETQVEGHSEDAVQKTKKSRIHDMEMKMLESRQILTTEMNKSWLGSFINTIIGNLKLSISSIHIRYEDIESNPGHPFAAGMTLEKLSASTVDDSGKEAFVTGGALELLHKSVELERLAVYLDSDITPWHIKKPWEDLKPSEWDQVFSFGTKDGKPATSLAEKHTYLLQPV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026198`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_026198`
Location	Chr05:122623899-122648246 (+)
Description	Similar to vps13A: Putative vacuolar protein sorting-associated protein 13A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_026198` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006623 protein targeting to vacuole Biological Process GO:0006869 lipid transport Biological Process GO:0007005 mitochondrion organization Biological Process GO:0045053 protein retention in Golgi apparatus Biological Process GO:0045324 late endosome to vacuole transport Biological Process GO:0120009 intermembrane lipid transfer Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005811 lipid droplet Cellular Component GO:0016020 membrane Cellular Component GO:0005543 phospholipid binding Molecular Function GO:0120014 phospholipid transfer activity Molecular Function
KEGG gene cross-reference	cthr:CTHT_0020450 ddi:DDB_G0274917 ddi:DDB_G0286725 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.321

Rank 1 · LXL04_026198 · OH-1004

Golgi apparatus0.290

Rank 2 · LXL04_026198 · OH-1004

Endoplasmic reticulum0.237

Rank 3 · LXL04_026198 · OH-1004

Cell membrane0.182

Rank 4 · LXL04_026198 · OH-1004

Nucleus0.162

Rank 5 · LXL04_026198 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12624.15VPS13_N1-674 aa

PF00169.36PH795-903 aa

PF25033.2VPS13_M1319-1694 aa

PF06101.17Vps621973-2124 aa

PF06101.17Vps622196-2342 aa

PF25033.2VPS13_M2383-2482 aa

PF25036.3VPS13_VAB2785-3084 aa

PF25036.3VPS13_VAB3188-3354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026198	`PF12624.15`	VPS13_N	1	674	1e-119	401.9
LXL04_026198	`PF00169.36`	PH	795	903	4.6e-08	34.2
LXL04_026198	`PF25033.2`	VPS13_M	1319	1694	2.3e-18	66.4
LXL04_026198	`PF06101.17`	Vps62	1973	2124	5.5e-34	118.1
LXL04_026198	`PF06101.17`	Vps62	2196	2342	5.5e-34	118.1
LXL04_026198	`PF25033.2`	VPS13_M	2383	2482	2.3e-18	66.4
LXL04_026198	`PF25036.3`	VPS13_VAB	2785	3084	1e-20	74.5
LXL04_026198	`PF25036.3`	VPS13_VAB	3188	3354	1e-20	74.5
LXL04_026198	`PF25037.2`	VPS13_C	3806	3913	1.6e-11	44.9
LXL04_026198	`PF06101.17`	Vps62	4093	4180	5.5e-34	118.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card