TkA01G162490 | RubberDandelionOmics

Gene overview

TkA01G162490

Reference: TK1151 Chr: Chr01 Coordinates: 41515289-41517700 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1536 bp · TkA01G162490|TK1151|cDNA

TTATTTATAACTGGTCAGACATTTGCTCTCGTGAATTTCGGAAGCAATGGAGGAGGGAAAAGAGGCGTTGTTGTCGCCGACGACACCGGGAGGCGGTAGGCGGGGACGGCGGTTGAGTAGGCGGTACTCCGTTAACTCACTCCGGAGCGATTTGTTGGCTCGGCTACCTGATAAGGTCCGTTCTGCTGTTGATATCGAATGTTCTTCACCTTTCGCTCTACCGTCTAAATCATCAGCTTCTCTAACTCAAGGTGAAAGGG...

CDS

Download CDS FASTA

1215 bp · TkA01G162490|TK1151|CDS

ATGGAGGAGGGAAAAGAGGCGTTGTTGTCGCCGACGACACCGGGAGGCGGTAGGCGGGGACGGCGGTTGAGTAGGCGGTACTCCGTTAACTCACTCCGGAGCGATTTGTTGGCTCGGCTACCTGATAAGGTCCGTTCTGCTGTTGATATCGAATGTTCTTCACCTTTCGCTCTACCGTCTAAATCATCAGCTTCTCTAACTCAAGGTGAAAGGGAGTATTATGAAAAGCAATTTGCAACATTGAAGTCTTTTGAGGAAGT...

Protein

Download Protein FASTA

404 aa · TkA01G162490|TK1151|PROTEIN

MEEGKEALLSPTTPGGGRRGRRLSRRYSVNSLRSDLLARLPDKVRSAVDIECSSPFALPSKSSASLTQGEREYYEKQFATLKSFEEVDAIVSSEGIDEEDLDEQLQQERAMKVSNYANILLLAFKIYATIETGSIAIAASTLDSLLDLMAGGILWFTHLSMQNINIYKYPIGKLRVQPVGIIIFAAIMATLGFQVLIQAVEQLIENNPPEKMSSLQLLWLYVIMLTATIVKLALWLYCKSSGNEIVRAYAKDHYFDVVTN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G162490`
TK1151 ID	TkA01G162490
OH-1004 ID	LXL04_004359
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G162490

Location Chr01:41515289-41517700 (-)

Description Similar to MTP4: Metal tolerance protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58060`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`At1g79520`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0226400`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`Os02g0775100`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`Os01g0837800`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004359 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006826 iron ion transport Biological Process

GO:0009845 seed germination Biological Process

GO:0048316 seed development Biological Process

GO:0071421 manganese ion transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0035618 root hair Cellular Component

GO:0005384 manganese ion transmembrane transporter activity Molecular Function

GO:0008324 monoatomic cation transmembrane transporter activity Molecular Function

GO:0010486 manganese:proton antiporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G79520

ath:AT3G58060

dosa:Os01g0837800

dosa:Os02g0775100

dosa:Os03g0226400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.349

Rank 1 · TkA01G162490 · TK1151

Cytoplasm0.296

Rank 2 · TkA01G162490 · TK1151

Endoplasmic reticulum0.252

Rank 3 · TkA01G162490 · TK1151

Lysosome / Vacuole0.207

Rank 4 · TkA01G162490 · TK1151

Cell membrane0.158

Rank 5 · TkA01G162490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01545Cation_efflux112-305 aa

PF25957DUF7994135-199 aa

PF25957DUF7994246-272 aa

PF16916ZT_dimer310-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G162490	`PF01545`	Cation_efflux	112	305	8.2e-29	101.5
TkA01G162490	`PF25957`	DUF7994	135	199	2.5	8.8
TkA01G162490	`PF25957`	DUF7994	246	272	2.5	8.8
TkA01G162490	`PF16916`	ZT_dimer	310	384	4.3e-10	40.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2P2`	Arabidopsis thaliana	sp\|Q9M2P2\|MTPC3_ARATH Putative metal tolerance protein C3	71.700%	Swiss-Prot	High
`Q9SAJ7`	Arabidopsis thaliana	sp\|Q9SAJ7\|MTP9_ARATH Metal tolerance protein 9	56.700%	Swiss-Prot	High
`Q10PP8`	Oryza sativa subsp. japonica	sp\|Q10PP8\|MTP4_ORYSJ Metal tolerance protein 4	74.600%	Swiss-Prot	High
`Q6Z7K5`	Oryza sativa subsp. japonica	sp\|Q6Z7K5\|MTP3_ORYSJ Metal tolerance protein 3	69.400%	Swiss-Prot	High
`Q5NA18`	Oryza sativa subsp. japonica	sp\|Q5NA18\|MTP5_ORYSJ Metal tolerance protein 5	55.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card