RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G113100
Reference: TK1151 Chr: Chr01 Coordinates: 28715499-28723991 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5505 bp · TkA01G113100|TK1151|cDNA

TATATATAGGGTTAGGTTACAATGAGAATCACAATTATTGTGTGGTGGTTGTCACATGGTGGTTTATTGGTGGCTCAAGGATGGTGAAAATTCCACATGCAAAGTATAATGTTATAAAGAATACTGATAAATGTTGGTGTTTTAAGGTTTTAGTTTTAGCTTCAGTATTCAGAATCAAACAAGAACTAGTGTTGGATTATAAGAAGCACCCCAACCACCAAGAGGTGACTTTATACCTTATTCAAAGTATATAGTCTTAA...

CDS

Download CDS FASTA

2916 bp · TkA01G113100|TK1151|CDS

ATGGCTTCGAAACAAGGTGGCATAAAACCTAGGAAATCGACTTCGAAGTATGCGAATACGCCGTCTTCATCAACGACTTCCTCTTCGAAACAGTTTCATGAACCGTTAGCTGAAAATCTGAGTTCTCCAGCTTCAACAGCTAGAAGCAAGCCACAGTACTCTTACTCAGAGAGTTTGCCTGTGAGTTCAGAGAGATCGAAAGAGAATGTCACGGTGACTGTCCGGTTCCGGCCTCTCAGTCCGAGGGAAATACGGCAAGG...

Protein

Download Protein FASTA

971 aa · TkA01G113100|TK1151|PROTEIN

MASKQGGIKPRKSTSKYANTPSSSTTSSSKQFHEPLAENLSSPASTARSKPQYSYSESLPVSSERSKENVTVTVRFRPLSPREIRQGEEIAWYADGETIVRNEHTPSIAYAYDRVFGPTTTTRHVYDIAAHHVVGGAMEGVNGTIFAYGVTSSGKTHTMHGNQRSPGIIPLAVKDAFSIIQETPSREFLLRVSYLEIYNEVVNDLLNPAGQNLRIREDNQGTFVEGIKEEVVLSPAHALSLIAAGEEHRHVGSTNFNLLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G113100
TK1151 IDTkA01G113100
OH-1004 IDLXL04_004775
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)96.000
Protein coverage (%)TK1151 98.764 / OH-1004 98.599
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G113100
LocationChr01:28715499-28723991 (-)
DescriptionSimilar to KIN7K: Kinesin-like protein KIN-7K, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g12020 Kinesin-like protein KIN-7K, chloroplastic. No verified direct reference in this release
At5g06670 Kinesin-like protein KIN-7L, chloroplastic. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os02g0775400 Probable minus end-directed motor protein with a microtubule-enhanced ATPase activity. No verified direct reference in this release
Os04g0434600 Kinesin-like protein KIN-7E, chloroplastic. No verified direct reference in this release
Os06g0206700 Kinesin-like protein KIN-7G. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_004775 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007018 microtubule-based movement Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005871 kinesin complex Cellular Component
GO:0005874 microtubule Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0000287 magnesium ion binding Molecular Function
GO:0003777 microtubule motor activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0008017 microtubule binding Molecular Function
GO:0016887 ATP hydrolysis activity Molecular Function
GO:0042803 protein homodimerization activity Molecular Function
GO:0043531 ADP binding Molecular Function
KEGG gene cross-reference
ath:AT3G12020
ath:AT5G06670
osa:9271714
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.717
Rank 1 · TkA01G113100 · TK1151
Nucleus0.260
Rank 2 · TkA01G113100 · TK1151
Cell membrane0.083
Rank 3 · TkA01G113100 · TK1151
Golgi apparatus0.060
Rank 4 · TkA01G113100 · TK1151
Lysosome / Vacuole0.058
Rank 5 · TkA01G113100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796Microtub_bd69-206 aa
PF00225Kinesin75-388 aa
PF19697Atg11_middle165-178 aa
PF30059DIA2_191-229 aa
PF16796Microtub_bd357-391 aa
PF30059DIA2_390-420 aa
PF23204KIF21A_2nd391-418 aa
PF19697Atg11_middle399-421 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G113100PF16796Microtub_bd692068.6e-1968.7
TkA01G113100PF00225Kinesin753881.2e-105353.9
TkA01G113100PF19697Atg11_middle1651780.0215.8
TkA01G113100PF30059DIA2_1912290.0215.4
TkA01G113100PF16796Microtub_bd3573918.6e-1968.7
TkA01G113100PF30059DIA2_3904200.0215.4
TkA01G113100PF23204KIF21A_2nd3914182.49.1
TkA01G113100PF19697Atg11_middle3994210.0215.8
TkA01G113100PF23204KIF21A_2nd7508152.49.1
TkA01G113100PF19697Atg11_middle7818150.0215.8
TkA01G113100PF23204KIF21A_2nd7968632.49.1
TkA01G113100PF19697Atg11_middle8248620.0215.8
TkA01G113100PF23204KIF21A_2nd8388672.49.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4J8L3Arabidopsis thalianasp|F4J8L3|KN7K_ARATH Kinesin-like protein KIN-7K, chloroplastic65.100%Swiss-ProtHigh
F4K3X8Arabidopsis thalianasp|F4K3X8|KN7L_ARATH Kinesin-like protein KIN-7L, chloroplastic63.900%Swiss-ProtHigh
Q6YZ52Oryza sativa subsp. japonicasp|Q6YZ52|KN7D_ORYSJ Kinesin-like protein KIN-7D, chloroplastic63.500%Swiss-ProtHigh
B9FFA3Oryza sativa subsp. japonicasp|B9FFA3|KN7E_ORYSJ Kinesin-like protein KIN-7E, chloroplastic53.300%Swiss-ProtHigh
B9FS33Oryza sativa subsp. japonicasp|B9FS33|KN7G_ORYSJ Kinesin-like protein KIN-7G55.500%Swiss-ProtHigh

JBrowse

View in Genome Browser