TkA01G095260 | RubberDandelionOmics

Gene overview

TkA01G095260

Reference: TK1151 Chr: Chr01 Coordinates: 24080808-24082827 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1419 bp · TkA01G095260|TK1151|cDNA

TTTATCGTTGTCTCCTATTTAATTTAGTTTATTATTTTTTTATTTTAGCAGTTCGAGATTTCGAGGAATATGCTATGCAATAACCCAAAATACTTCCAGATTGGGGATCTACAATTCTTTATCAACGTCAAATAGGTCGTTGTTTGCTCATTTCTTCTTCTTTGCTTCCCCTTTCGCTCTGTAATTCAGCCGTCAAATCCACCCATGGCGGCCATCACCCGCCTTCTGAAACCATCATCGTCTCCATCAATCTCATATCT...

CDS

Download CDS FASTA

864 bp · TkA01G095260|TK1151|CDS

ATGGCGGCCATCACCCGCCTTCTGAAACCATCATCGTCTCCATCAATCTCATATCTATTCCAGAGATCACTTTCCACCACCACCGCCGTGGTTTCCGAATTTGAATCTCAACACAACCGGCGCCCTCACCCTAATTTCTCCGATCCTAAGGGTTCTAGAAATGTCCAGTGGGTGTTCCTTGGTGCTCCGGGCGTCGGAAAGGGAACTTATGCTAGTCGCCTTTCGACTCTTCTAGGTGTCCCTCACATCGCCACCGGAGA...

Protein

Download Protein FASTA

287 aa · TkA01G095260|TK1151|PROTEIN

MAAITRLLKPSSSPSISYLFQRSLSTTTAVVSEFESQHNRRPHPNFSDPKGSRNVQWVFLGAPGVGKGTYASRLSTLLGVPHIATGDLVRDEVSSSRPLAAQLSEIMNSGKLVPDEIIFNLLSKRLEAGESKGESGFILDGFPRTIRQAEILNKVTEIDLVVNLKMREDVLVQKCLGRRTCSQCGKGFNVASINAKAENGRPAMSMAPLLQPPNCTVKLSTRADDTEEIINERLRVYKESSQPVEDFYRNEGKLMEFDLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G095260`
TK1151 ID	TkA01G095260
OH-1004 ID	LXL04_012646
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	73.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G095260

Location Chr01:24080808-24082827 (+)

Description Similar to ADK: Adenylate kinase 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37250`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	Deficiency of a plastidial adenylate kinase in Arabidopsis results in elevated photosynthetic amino acid biosynthesis and enhanced growth.2005 · DOI: 10.1104/pp.104.056143
`At2g39270`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0130400`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release
`Os04g0671100`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012646 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008652 amino acid biosynthetic process Biological Process

GO:0048364 root development Biological Process

GO:0048367 shoot system development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004017 AMP kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G37250

ath:AT2G39270

dosa:Os03g0130400

dosa:Os04g0671100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.771

Rank 1 · TkA01G095260 · TK1151

Plastid0.218

Rank 2 · TkA01G095260 · TK1151

Cytoplasm0.063

Rank 3 · TkA01G095260 · TK1151

Nucleus0.049

Rank 4 · TkA01G095260 · TK1151

Cell membrane0.012

Rank 5 · TkA01G095260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13671AAA_3357-97 aa

PF13521AAA_2858-83 aa

PF00406ADK60-252 aa

PF13207AAA_1760-180 aa

PF13238AAA_1860-180 aa

PF05191ADK_lid178-192 aa

PF05191ADK_lid215-224 aa

PF13207AAA_17225-235 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G095260	`PF13671`	AAA_33	57	97	0.1	13.6
TkA01G095260	`PF13521`	AAA_28	58	83	0.18	12.8
TkA01G095260	`PF00406`	ADK	60	252	1.7e-40	139.3
TkA01G095260	`PF13207`	AAA_17	60	180	6.5e-22	79.0
TkA01G095260	`PF13238`	AAA_18	60	180	7.5e-05	23.9
TkA01G095260	`PF05191`	ADK_lid	178	192	0.022	15.4
TkA01G095260	`PF05191`	ADK_lid	215	224	0.022	15.4
TkA01G095260	`PF13207`	AAA_17	225	235	6.5e-22	79.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUU1`	Arabidopsis thaliana	sp\|Q9ZUU1\|KAD1_ARATH Adenylate kinase 1, chloroplastic	70.700%	Swiss-Prot	High
`Q84JF7`	Arabidopsis thaliana	sp\|Q84JF7\|KAD6C_ARATH Probable adenylate kinase 6, chloroplastic	59.400%	Swiss-Prot	High
`Q10S93`	Oryza sativa subsp. japonica	sp\|Q10S93\|KAD1_ORYSJ Probable adenylate kinase 1, chloroplastic	72.800%	Swiss-Prot	High
`Q7XR47`	Oryza sativa subsp. japonica	sp\|Q7XR47\|KAD6_ORYSJ Probable adenylate kinase 6, chloroplastic	71.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card