TkA01G079580 | RubberDandelionOmics

Gene overview

TkA01G079580

Reference: TK1151 Chr: Chr01 Coordinates: 20374104-20374535 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

432 bp · TkA01G079580|TK1151|cDNA

GAGAAGAACAAACATCAGAAATACATCGAAGAAAAGATTTCGTTTCCATGGAGCTACGCTCATGTCGGAACAGAGATTCAATTGGATCATTTCGATTCGCCGTTTTTGAAGCGAACGAAAGACATTAGTTGTGCTCATAACCTTGAAGCTCTTTTGCATCTGGTTGATGGGTATCGTGGTCGAGATCGAGGGTTTTGTTCTGAAACGAATAGGGATATTGCACTTGTGAACAAGAGTTGTGATTTCTTGAAAGAGGAGTA...

CDS

Download CDS FASTA

432 bp · TkA01G079580|TK1151|CDS

GAGAAGAACAAACATCAGAAATACATCGAAGAAAAGATTTCGTTTCCATGGAGCTACGCTCATGTCGGAACAGAGATTCAATTGGATCATTTCGATTCGCCGTTTTTGAAGCGAACGAAAGACATTAGTTGTGCTCATAACCTTGAAGCTCTTTTGCATCTGGTTGATGGGTATCGTGGTCGAGATCGAGGGTTTTGTTCTGAAACGAATAGGGATATTGCACTTGTGAACAAGAGTTGTGATTTCTTGAAAGAGGAGTA...

Protein

Download Protein FASTA

143 aa · TkA01G079580|TK1151|PROTEIN

EKNKHQKYIEEKISFPWSYAHVGTEIQLDHFDSPFLKRTKDISCAHNLEALLHLVDGYRGRDRGFCSETNRDIALVNKSCDFLKEEYGVPAYWRQDENKGMVRASDGRWILPERPVVDSHPPDTAYHLEQVLKFAANTTLNAL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G079580`
TK1151 ID	TkA01G079580
OH-1004 ID	LXL04_003462
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	44.700
Protein coverage (%)	TK1151 78.322 / OH-1004 23.554 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G079580

Location Chr01:20374104-20374535 (-)

Description Similar to At1g06800: Phospholipase A1-Igamma1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51440`	Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine at the sn-1 position.	No verified direct reference in this release
`At2g30550`	Acylhydrolase with broad specificity.	No verified direct reference in this release
`At1g06800`	Acylhydrolase with a broad specificity.	DONGLE and DEFECTIVE IN ANTHER DEHISCENCE1 lipases are not essential for wound- and pathogen-induced jasmonate biosynthesis: redundant lipases contribute to jasmonate formation.2010 · DOI: 10.1104/pp.110.155093

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0652300`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release
`UniProt: A2WT95`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003462 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010582 floral meristem determinacy Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0048449 floral organ formation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004620 glycerophospholipase activity Molecular Function

GO:0004806 triacylglycerol lipase activity Molecular Function

GO:0008970 glycerophospholipid phospholipase A1 activity Molecular Function

GO:0047714 galactolipase activity Molecular Function

KEGG gene cross-reference

ath:AT1G06800

ath:AT1G51440

ath:AT2G30550

dosa:Os01g0900400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.434

Rank 1 · TkA01G079580 · TK1151

Cytoplasm0.402

Rank 2 · TkA01G079580 · TK1151

Mitochondrion0.109

Rank 3 · TkA01G079580 · TK1151

Extracellular0.078

Rank 4 · TkA01G079580 · TK1151

Cell membrane0.060

Rank 5 · TkA01G079580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8J6`	Arabidopsis thaliana	sp\|Q9C8J6\|PLA17_ARATH Phospholipase A1-Igamma3, chloroplastic	67.900%	Swiss-Prot	High
`Q3EBR6`	Arabidopsis thaliana	sp\|Q3EBR6\|PLA16_ARATH Phospholipase A1-Igamma2, chloroplastic	58.100%	Swiss-Prot	High
`Q941F1`	Arabidopsis thaliana	sp\|Q941F1\|PLA15_ARATH Phospholipase A1-Igamma1, chloroplastic	59.000%	Swiss-Prot	High
`B9EYD3`	Oryza sativa subsp. japonica	sp\|B9EYD3\|PLA4_ORYSJ Phospholipase A1-II 4	47.900%	Swiss-Prot	Medium
`A2WT95`	Oryza sativa subsp. indica	sp\|A2WT95\|PLA1_ORYSI Phospholipase A1-II 1	45.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card